|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
194245_x_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.25760
|
|
Exemplar sequence
|
|
CEK071F8R NCBI
|
|
CEK071F8R_rc /REP_DB=TREMBL Accession /5_PRIME_EXT_ID=F42F12.1 /5_PRIME_EXT_DB=WormBase Gene ID /GB=D65968 /WB_GENE_ID=F42F12.1 /WP=CE03312 /CHR=X /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk71f8 : 3prime end, single read.
|
This cluster is supported by a Genomic Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Genome Target Overlap based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade B annotation. |
|
NM_077672, NM_001029176 |
|
|
|
|
|
GENEFINDER00000001338 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:X:12340490:12343777:-1 |
|
None |
GENEFINDER00000001336 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:X:12356006:12361042:1 |
|
None |
NM_001029176 NCBI |
Caenorhabditis elegans Nematode Specific Peptide family, group C family member (nspc-3) (nspc-3) mRNA, complete cds. |
|
None |
F42F12.6 ENSEMBL |
cdna:known chromosome:CEL140:X:12357429:12357779:1 gene:F42F12.6 |
|
A |
SNAP00000001333 ENSEMBL |
cdna:SNAP chromosome:CEL140:X:12356179:12356668:-1 |
|
None |
NM_077672 NCBI |
Caenorhabditis elegans Nematode Specific Peptide family, group C family member (nspc-13) (nspc-13) mRNA, complete cds. |
|
A | |
NM_001029179 |
2/11 |
Cross Hyb Matching Probes |
None |
NM_001029178 |
2/11 |
Cross Hyb Matching Probes |
None |
NM_001029177 |
2/11 |
Cross Hyb Matching Probes |
None |
NM_171744 |
2/11 |
Cross Hyb Matching Probes |
B |
NM_001029182 |
2/11 |
Cross Hyb Matching Probes |
None |
NM_001029181 |
2/11 |
Cross Hyb Matching Probes |
None |
NM_077669 |
8/11 |
Cross Hyb Matching Probes |
None |
NM_182450 |
5/11 |
Cross Hyb Matching Probes |
None |
NM_001029486 |
6/11 |
Cross Hyb Matching Probes |
None |
NM_182449 |
6/11 |
Cross Hyb Matching Probes |
None |
NM_077673 |
6/11 |
Cross Hyb Matching Probes |
None |
SNAP00000001329 |
4/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000026294 |
2/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000026296 |
3/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000026297 |
2/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000026295 |
2/11 |
Cross Hyb Matching Probes |
None |
C03G5.8 |
2/11 |
Cross Hyb Matching Probes |
None |
C03G5.2 |
2/11 |
Cross Hyb Matching Probes |
None |
F42F12.1 |
8/11 |
Cross Hyb Matching Probes |
None |
F42F12.9 |
5/11 |
Cross Hyb Matching Probes |
None |
F42F12.10 |
6/11 |
Cross Hyb Matching Probes |
None |
F42F12.7 |
6/11 |
Cross Hyb Matching Probes |
None |
F42F12.8.2 |
6/11 |
Cross Hyb Matching Probes |
B |
F42F12.8.1 |
6/11 |
Cross Hyb Matching Probes |
B | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrX:12356306-12357780(+) |
90.09 |
90.09 |
|
chrX:12342886-12343778(-) |
100.0 |
100.0 |
|
chrX:12358546-12360914(-) |
97.2 |
97.2 |
|
chrX:12353422-12357651(-) |
92.15 |
92.15 |
| |
Public Domain and Genome References |
|
|
|
nspc-3 nspc-13
|
|
F42F12.6
|
|
185671 Entrez gene 3565449 Entrez gene
|
|
Q20342 EMBL-EBI
|
|
CE38675 Wormbase CE31939 Wormbase
|
Functional Annotations |
|
|
|
|
|
blast |
CAA92170 |
Hypothetical protein F42F12.2 [Caenorhabditis elegans] ref|NP_510069.1| 2 (Zwei) IG-domain protein family member (zig-2) [Caenorhabditis elegans] gb|AAL59607.1| secreted 2-immunoglobulin-domain protein ZIG-2 [Caenorhabditis elegans] |
1.0E-124 |
blast |
AAY55843 |
Nematode specific peptide family, group c protein 3 [Caenorhabditis elegans] ref|NP_001024347.1| Nematode Specific Peptide family, group C family member (nspc-3) [Caenorhabditis elegans] |
4.0E-57 |
blast |
CAA92172 |
Hypothetical protein F42F12.6 [Caenorhabditis elegans] emb|CAA92171.2| Hypothetical protein F42F12.7 [Caenorhabditis elegans] ref|NP_510073.2| Nematode Specific Peptide family, group C family member (nspc-13) [Caenorhabditis elegans] ref|NP_872249.1| Nematode Specific Peptide family, group C family member (nspc-14) [Caenorhabditis elegans] |
1.0E-56 |
blast |
AAU05596 |
Nematode specific peptide family, group c protein 1 [Caenorhabditis elegans] ref|NP_001024352.1| Nematode Specific Peptide family, group C family member (nspc-1) [Caenorhabditis elegans] |
2.0E-56 |
blast |
CAH60761 |
Hypothetical protein F42F12.10 [Caenorhabditis elegans] emb|CAD54144.1| Hypothetical protein F42F12.8 [Caenorhabditis elegans] ref|NP_510074.2| Nematode Specific Peptide family, group C family member (nspc-15) [Caenorhabditis elegans] ref|NP_001024657.1| Nematode Specific Peptide family, group C family member (nspc-12) [Caenorhabditis elegans] |
3.0E-56 |
blast |
CAA92174 |
Hypothetical protein F42F12.1 [Caenorhabditis elegans] ref|NP_510070.2| Nematode Specific Peptide family, group C family member (nspc-9) [Caenorhabditis elegans] |
6.0E-56 |
blast |
AAL65774 |
Nematode specific peptide family, group c protein 7 [Caenorhabditis elegans] ref|NP_741862.1| Nematode Specific Peptide family, group C family member (nspc-7) [Caenorhabditis elegans] |
1.0E-55 |
blast |
CAH60761 |
Hypothetical protein F42F12.10 [Caenorhabditis elegans] emb|CAD54144.1| Hypothetical protein F42F12.8 [Caenorhabditis elegans] ref|NP_510074.2| Nematode Specific Peptide family, group C family member (nspc-15) [Caenorhabditis elegans] ref|NP_001024657.1| Nematode Specific Peptide family, group C family member (nspc-12) [Caenorhabditis elegans] |
3.0E-55 | |
|
|
|
|
|
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
0.043 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
0.0015 |
|
Sequence |
|
>C. ELEGANS:194245_X_AT
gtaagattcaccaccattgacaccagcacagaactcttgacagagttgcaaggtgatgga
gctgatggcagaaacaaggcaaaggacaacgagggtgcgaaggaactgcaaggatattca
atgttacttcgcaccctcgttgccctttgcttggtttctgccatcagctccatcaccttg
caactctgtcaagagttctgtgctggtgtcaatggtggtgaatcttacgcattctgctct
ccatggatcagttttgccactcaaaccaacaaaacttgctacaatctctgtgttcataac
tgtgctgctgtctatgatggttcctgcacaactgatcctgacttcagatgctgcttgaaa
accactcca
BLASTn GenBank NR |
|
|
|
|
|
|
GTAAGATTCACCACCATTGACACCA |
92 |
463 |
83 |
Antisense |
TTGACACCAGCACAGAACTCTTGAC |
347 |
703 |
99 |
Antisense |
ATATTCAATGTTACTTCGCACCCTC |
511 |
19 |
196 |
Antisense |
TCCATCACCTTGCAACTCTGTCAAG |
394 |
591 |
251 |
Antisense |
GTCAAGAGTTCTGTGCTGGTGTCAA |
405 |
463 |
270 |
Antisense |
GTGGTGAATCTTACGCATTCTGCTC |
566 |
489 |
297 |
Antisense |
CATTCTGCTCTCCATGGATCAGTTT |
376 |
217 |
312 |
Antisense |
AACTTGCTACAATCTCTGTGTTCAT |
331 |
139 |
355 |
Antisense |
GTGTTCATAACTGTGCTGCTGTCTA |
217 |
485 |
372 |
Antisense |
TGCTGTCTATGATGGTTCCTGCACA |
320 |
579 |
388 |
Antisense |
CAGATGCTGCTTGAAAACCACTCCA |
235 |
207 |
427 |
Antisense | |
|
Affymetrix Proprietary Database |