|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
194223_x_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.22098
|
|
Exemplar sequence
|
|
CEC3896 NCBI
|
|
CEC3896 /REP_DB=TREMBL Accession /GB=C13389 /CHR=X /FEA=Genomic Cluster /DEF=C.elegans cDNA clone yk170h12 : 5prime end, single read.
|
This cluster is supported by a Genomic Cluster. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001029179(11), NM_001029178(10), NM_001029182(11) |
|
|
|
|
|
NM_001029179 NCBI |
Caenorhabditis elegans Nematode Specific Peptide family, group C family member (nspc-6) (nspc-6) mRNA, complete cds. |
11/11 |
None |
NM_001029178 NCBI |
Caenorhabditis elegans Nematode Specific Peptide family, group C family member (nspc-5) (nspc-5) mRNA, complete cds. |
10/11 |
None |
NM_001029182 NCBI |
Caenorhabditis elegans Nematode Specific Peptide family, group C family member (nspc-2) (nspc-2) mRNA, complete cds. |
11/11 |
None |
GENEFINDER00000026294 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:X:8534545:8535756:1 |
11/11 |
None |
GENEFINDER00000026297 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:X:8538064:8539200:1 |
10/11 |
None |
GENEFINDER00000026295 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:X:8541083:8542013:-1 |
11/11 |
None | |
NM_001029177 |
3/11 |
Cross Hyb Matching Probes |
None |
NM_171744 |
4/11 |
Cross Hyb Matching Probes |
B |
NM_001029181 |
3/11 |
Cross Hyb Matching Probes |
None |
NM_001029176 |
3/11 |
Cross Hyb Matching Probes |
None |
NM_077669 |
1/11 |
Cross Hyb Matching Probes |
B |
NM_182450 |
1/11 |
Cross Hyb Matching Probes |
B |
NM_001029486 |
1/11 |
Cross Hyb Matching Probes |
None |
NM_182449 |
1/11 |
Cross Hyb Matching Probes |
B |
NM_077673 |
1/11 |
Cross Hyb Matching Probes |
B |
SNAP00000001329 |
1/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000001336 |
1/11 |
Cross Hyb Matching Probes |
None |
SNAP00000001333 |
1/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000026296 |
3/11 |
Cross Hyb Matching Probes |
None |
C03G5.8 |
3/11 |
Cross Hyb Matching Probes |
None |
C03G5.2 |
4/11 |
Cross Hyb Matching Probes |
None |
F42F12.1 |
1/11 |
Cross Hyb Matching Probes |
None |
F42F12.9 |
1/11 |
Cross Hyb Matching Probes |
B |
F42F12.10 |
1/11 |
Cross Hyb Matching Probes |
None |
F42F12.7 |
1/11 |
Cross Hyb Matching Probes |
None |
F42F12.8.2 |
1/11 |
Cross Hyb Matching Probes |
B |
F42F12.8.1 |
1/11 |
Cross Hyb Matching Probes |
B | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrX:8535460-8535794(+) |
100.0 |
100.0 |
|
chrX:8541042-8541376(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
|
|
nspc-5 nspc-6 nspc-2
|
|
3564795 Entrez gene 3564889 Entrez gene 3566000 Entrez gene
|
|
CE38677 Wormbase CE38677 Wormbase CE38677 Wormbase
|
Functional Annotations |
|
|
|
|
|
blast |
AAY55847 |
Nematode specific peptide family, group c protein 2 [Caenorhabditis elegans] gb|AAY55846.1| Nematode specific peptide family, group c protein 6 [Caenorhabditis elegans] gb|AAY55845.1| Nematode specific peptide family, group c protein 5 [Caenorhabditis elegans] ref|NP_001024350.1| Nematode Specific Peptide family, group C family member (nspc-6) [Caenorhabditis elegans] ref|NP_001024353.1| Nematode Specific Peptide family, group C family member (nspc-2) [Caenorhabditis elegans] ref|NP_001024349.1| Nematode Specific Peptide family, group C family member (nspc-5) [Caenorhabditis elegans] |
9.0E-57 |
blast |
AAY55847 |
Nematode specific peptide family, group c protein 2 [Caenorhabditis elegans] gb|AAY55846.1| Nematode specific peptide family, group c protein 6 [Caenorhabditis elegans] gb|AAY55845.1| Nematode specific peptide family, group c protein 5 [Caenorhabditis elegans] ref|NP_001024350.1| Nematode Specific Peptide family, group C family member (nspc-6) [Caenorhabditis elegans] ref|NP_001024353.1| Nematode Specific Peptide family, group C family member (nspc-2) [Caenorhabditis elegans] ref|NP_001024349.1| Nematode Specific Peptide family, group C family member (nspc-5) [Caenorhabditis elegans] |
5.0E-56 |
blast |
AAY55844 |
Nematode specific peptide family, group c protein 4 [Caenorhabditis elegans] ref|NP_001024348.1| Nematode Specific Peptide family, group C family member (nspc-4) [Caenorhabditis elegans] |
7.0E-56 |
blast |
AAY55847 |
Nematode specific peptide family, group c protein 2 [Caenorhabditis elegans] gb|AAY55846.1| Nematode specific peptide family, group c protein 6 [Caenorhabditis elegans] gb|AAY55845.1| Nematode specific peptide family, group c protein 5 [Caenorhabditis elegans] ref|NP_001024350.1| Nematode Specific Peptide family, group C family member (nspc-6) [Caenorhabditis elegans] ref|NP_001024353.1| Nematode Specific Peptide family, group C family member (nspc-2) [Caenorhabditis elegans] ref|NP_001024349.1| Nematode Specific Peptide family, group C family member (nspc-5) [Caenorhabditis elegans] |
8.0E-56 |
blast |
AAY55847 |
Nematode specific peptide family, group c protein 2 [Caenorhabditis elegans] gb|AAY55846.1| Nematode specific peptide family, group c protein 6 [Caenorhabditis elegans] gb|AAY55845.1| Nematode specific peptide family, group c protein 5 [Caenorhabditis elegans] ref|NP_001024350.1| Nematode Specific Peptide family, group C family member (nspc-6) [Caenorhabditis elegans] ref|NP_001024353.1| Nematode Specific Peptide family, group C family member (nspc-2) [Caenorhabditis elegans] ref|NP_001024349.1| Nematode Specific Peptide family, group C family member (nspc-5) [Caenorhabditis elegans] |
1.0E-55 |
blast |
AAL65774 |
Nematode specific peptide family, group c protein 7 [Caenorhabditis elegans] ref|NP_741862.1| Nematode Specific Peptide family, group C family member (nspc-7) [Caenorhabditis elegans] |
2.0E-55 | |
Sequence |
|
>C. ELEGANS:194223_X_AT
ttgccttgtttctgctatcagtaccattaccttggaactctgtcaagaattctgtgctgg
tgtcaacggtggtgaatcttacgcatactgctctccatggatcagtttcgccactcaaac
caacaagacttgctataatctctgtgttcataactgtgctgctgtctatgatggttcctg
cactaccgaccctgacttcagatgctgcttgaaaaccactccagctaagactcaagaatt
caagactagtggctgcaacaagctttat
BLASTn GenBank NR |
|
|
|
|
|
|
TTGCCTTGTTTCTGCTATCAGTACC |
75 |
703 |
28 |
Antisense |
GTACCATTACCTTGGAACTCTGTCA |
611 |
457 |
48 |
Antisense |
AGAATTCTGTGCTGGTGTCAACGGT |
65 |
77 |
73 |
Antisense |
TGAATCTTACGCATACTGCTCTCCA |
458 |
575 |
100 |
Antisense |
TGCTCTCCATGGATCAGTTTCGCCA |
472 |
581 |
116 |
Antisense |
GACTTGCTATAATCTCTGTGTTCAT |
573 |
371 |
154 |
Antisense |
GTGTTCATAACTGTGCTGCTGTCTA |
216 |
485 |
171 |
Antisense |
GTCTATGATGGTTCCTGCACTACCG |
30 |
469 |
191 |
Antisense |
CGACCCTGACTTCAGATGCTGCTTG |
278 |
251 |
214 |
Antisense |
AAAACCACTCCAGCTAAGACTCAAG |
237 |
131 |
239 |
Antisense |
GACTAGTGGCTGCAACAAGCTTTAT |
656 |
371 |
271 |
Antisense | |
|
Affymetrix Proprietary Database |