|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
194143_x_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.28087
|
|
Exemplar sequence
|
|
4688643 NCBI
|
|
g4688643 /REP_DB=GenBank Identifier /FEA=mRNA Transcript
|
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_170960(11) |
|
|
|
|
|
NM_170960 NCBI |
Caenorhabditis elegans protein KINase family member (kin-1) (kin-1) mRNA, complete cds. |
11/11 |
A |
ZK909.2g ENSEMBL |
cdna:known chromosome:CEL140:I:14931083:14959685:1 gene:ZK909.2 |
11/11 |
A | |
NM_170958 |
3/11 |
Cross Hyb Matching Probes |
A |
NM_170959 |
3/11 |
Cross Hyb Matching Probes |
A |
NM_170961 |
7/11 |
Cross Hyb Matching Probes |
A |
NM_061205 |
3/11 |
Cross Hyb Matching Probes |
A |
NM_061204 |
3/11 |
Cross Hyb Matching Probes |
A |
NM_170962 |
3/11 |
Cross Hyb Matching Probes |
A |
NM_170963 |
3/11 |
Cross Hyb Matching Probes |
A |
NM_170964 |
3/11 |
Cross Hyb Matching Probes |
A |
NM_170965 |
3/11 |
Cross Hyb Matching Probes |
A |
NM_170967 |
3/11 |
Cross Hyb Matching Probes |
A |
NM_170966 |
3/11 |
Cross Hyb Matching Probes |
A |
ZK909.2h.1 |
3/11 |
Cross Hyb Matching Probes |
None |
ZK909.2h.2 |
3/11 |
Cross Hyb Matching Probes |
None |
ZK909.2j |
3/11 |
Cross Hyb Matching Probes |
A |
ZK909.2i |
7/11 |
Cross Hyb Matching Probes |
A |
ZK909.2b |
3/11 |
Cross Hyb Matching Probes |
A |
ZK909.2a |
3/11 |
Cross Hyb Matching Probes |
A |
ZK909.2f |
3/11 |
Cross Hyb Matching Probes |
A |
ZK909.2k |
3/11 |
Cross Hyb Matching Probes |
A |
ZK909.2l |
3/11 |
Cross Hyb Matching Probes |
A |
ZK909.2e |
3/11 |
Cross Hyb Matching Probes |
A |
ZK909.2d |
3/11 |
Cross Hyb Matching Probes |
A |
ZK909.2m |
3/11 |
Cross Hyb Matching Probes |
A | |
|
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:14931013-14949011(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
ZK909.2
|
Functional Annotations |
|
|
|
|
|
blast |
CAD45618 |
Hypothetical protein ZK909.2g [Caenorhabditis elegans] emb|CAD45585.1| Hypothetical protein ZK909.2g [Caenorhabditis elegans] ref|NP_740956.1| protein KINase family member (kin-1) [Caenorhabditis elegans] |
0.0 |
blast |
CAD45617 |
Hypothetical protein ZK909.2f [Caenorhabditis elegans] emb|CAD45584.1| Hypothetical protein ZK909.2f [Caenorhabditis elegans] ref|NP_740958.1| protein KINase family member (kin-1) [Caenorhabditis elegans] |
0.0 |
blast |
CAD45619 |
Hypothetical protein ZK909.2h [Caenorhabditis elegans] emb|CAD45586.1| Hypothetical protein ZK909.2h [Caenorhabditis elegans] ref|NP_740954.1| protein KINase family member (kin-1) [Caenorhabditis elegans] |
0.0 | |
|
|
|
|
|
ec |
A2S7_HUMAN |
(Q96Q40) Serine/threonine-protein kinase ALS2CR7 (EC 2.7.1.37) (Amyotrophic lateral sclerosis 2 chromosomal region candidate gene protein 7) |
3.0E-68 |
hanks |
1.1.4 |
AGC group; AGC I Cyclic nucleotide regulated protein kinase (PKA & PKG); EcAPKa |
1.0E-146 | |
|
|
|
|
|
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
5.7E-89 |
Pfam |
IPR000961 EMBL-EBI |
Protein kinase C-terminal domain |
6.1E-6 | |
Sequence |
|
>C. ELEGANS:194143_X_AT
aaagctgacgccatgggatccatggtgttcattgtcaaagaattcctggacaaggcacgc
gaagac
BLASTn GenBank NR |
|
|
|
|
|
|
AAAGCTGACGCCATGGGATCCATGG |
191 |
123 |
13 |
Antisense |
GCTGACGCCATGGGATCCATGGTGT |
139 |
297 |
16 |
Antisense |
GACGCCATGGGATCCATGGTGTTCA |
480 |
381 |
19 |
Antisense |
CATGGGATCCATGGTGTTCATTGTC |
684 |
209 |
24 |
Antisense |
ATGGGATCCATGGTGTTCATTGTCA |
689 |
49 |
25 |
Antisense |
GGGATCCATGGTGTTCATTGTCAAA |
644 |
493 |
27 |
Antisense |
GGATCCATGGTGTTCATTGTCAAAG |
325 |
513 |
28 |
Antisense |
GGTGTTCATTGTCAAAGAATTCCTG |
695 |
499 |
36 |
Antisense |
AAGAATTCCTGGACAAGGCACGCGA |
631 |
151 |
50 |
Antisense |
GAATTCCTGGACAAGGCACGCGAAG |
92 |
323 |
52 |
Antisense |
ATTCCTGGACAAGGCACGCGAAGAC |
185 |
9 |
54 |
Antisense | |
|
GenBank |