|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
194134_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.3863
|
|
Exemplar sequence
|
|
C09D8.1 NCBI
|
|
C09D8.1 /REP_DB=WormBase Gene ID /WP=CE24794 /GEN=ptp-3 /TR=Q17859 /GB=CAA90189.2 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation /DEF=protein-tyrosine phosphatase with fibronectin type III-like domains (DPTP and LAR like)
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq,GenBank identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001026771(11), NM_001026772(11), NM_001026773(11), AF316540(11) |
|
|
|
|
|
NM_001026771 NCBI |
Caenorhabditis elegans Protein Tyrosine Phosphatase family member (ptp-3) (ptp-3) mRNA, complete cds. |
11/11 |
None |
NM_001026772 NCBI |
Caenorhabditis elegans Protein Tyrosine Phosphatase family member (ptp-3) (ptp-3) mRNA, complete cds. |
11/11 |
None |
NM_001026773 NCBI |
Caenorhabditis elegans Protein Tyrosine Phosphatase family member (ptp-3) (ptp-3) mRNA, complete cds. |
11/11 |
None |
AF316540 NCBI |
Caenorhabditis elegans PTP-3B (ptp-3B) mRNA, complete cds. |
11/11 |
None |
SNAP00000020587 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:11006169:11011694:1 |
11/11 |
None |
GENEFINDER00000020593 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:11006169:11011694:1 |
11/11 |
None |
C09D8.1a ENSEMBL |
cdna:known chromosome:CEL140:II:10975450:11012152:1 gene:C09D8.1 |
11/11 |
A |
C09D8.1b ENSEMBL |
cdna:known chromosome:CEL140:II:10993509:11011694:1 gene:C09D8.1 |
11/11 |
None |
C09D8.1c ENSEMBL |
cdna:known chromosome:CEL140:II:11002892:11011694:1 gene:C09D8.1 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:10975446-11011691(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
C09D8.1
|
Functional Annotations |
|
|
|
|
|
blast |
CAA90189 |
Hypothetical protein C09D8.1a [Caenorhabditis elegans] emb|CAA86842.3| Hypothetical protein C09D8.1a [Caenorhabditis elegans] ref|NP_001021942.1| Protein Tyrosine Phosphatase family member (ptp-3) [Caenorhabditis elegans] |
0.0 |
blast |
AAK01632 |
PTP-3A [Caenorhabditis elegans] sp|Q9BMN8|LAR_CAEEL Tyrosine-protein phosphatase Lar-like precursor (Protein-tyrosine phosphate 3) |
0.0 |
blast |
CAD31752 |
Hypothetical protein C09D8.1b [Caenorhabditis elegans] emb|CAD31753.1| Hypothetical protein C09D8.1b [Caenorhabditis elegans] ref|NP_001021943.1| Protein Tyrosine Phosphatase family member (ptp-3) [Caenorhabditis elegans] |
0.0 |
blast |
AAK01633 |
PTP-3B [Caenorhabditis elegans] |
0.0 |
blast |
CAD59171 |
Hypothetical protein C09D8.1c [Caenorhabditis elegans] ref|NP_001021944.1| Protein Tyrosine Phosphatase family member (ptp-3) [Caenorhabditis elegans] |
0.0 | |
|
|
|
|
|
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
9.4E-15 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
7.9E-17 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.0E-18 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
9.9E-16 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.5E-17 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
2.0E-8 |
Pfam |
IPR000242 EMBL-EBI |
Tyrosine specific protein phosphatase |
1.0E-126 |
Pfam |
IPR000242 EMBL-EBI |
Tyrosine specific protein phosphatase |
1.4E-103 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
1.6E-4 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
1.9E-4 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
6.9E-4 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.5E-17 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
2.0E-8 |
Pfam |
IPR000242 EMBL-EBI |
Tyrosine specific protein phosphatase |
1.0E-126 |
Pfam |
IPR000242 EMBL-EBI |
Tyrosine specific protein phosphatase |
1.4E-103 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.3E-7 |
Pfam |
IPR000242 EMBL-EBI |
Tyrosine specific protein phosphatase |
1.0E-126 |
Pfam |
IPR000242 EMBL-EBI |
Tyrosine specific protein phosphatase |
1.4E-103 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
2.0E-8 |
Pfam |
IPR000242 EMBL-EBI |
Tyrosine specific protein phosphatase |
1.0E-126 |
Pfam |
IPR000242 EMBL-EBI |
Tyrosine specific protein phosphatase |
1.4E-103 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
2.0E-8 |
Pfam |
IPR000242 EMBL-EBI |
Tyrosine specific protein phosphatase |
1.0E-126 |
Pfam |
IPR000242 EMBL-EBI |
Tyrosine specific protein phosphatase |
1.4E-103 |
NP_001021942.1 |
1 |
20-42 |
C09D8.1a |
1 |
20-42 |
SNAP00000020587 |
1 |
7-29 |
GENEFINDER00000020593 |
1 |
7-29 | |
Sequence |
|
>C. ELEGANS:194134_AT
acaaagagcgcggagcctacattgccactcaagcaccaactaacgagacagccgcagatt
tttggcgagcaatttgggagcataacagcccgataatcgccatgctggtacggacaaacg
aacgaggacaagagcaatgtagtgactattggccattggaaactggagttcaagttggaa
tgctcgtcgttgagccgatggctgaatatgatatgaaacattatcatcttcgagagttta
ggatttcggatattaatactcgcgaagtccgaaccgttcgtcaattccatttcatggagt
ggcctgatgtcggaaagccgcacacagcagatcacttcctcgactttgtcacccaagttc
acaatacgtatgctcaattcggatgtactggcccgattacagtacactgttgctctggag
ccggacgcactgcagtcttcatcgcactttcgatcattttggataggatgcgtgctgagc
atgttgttgatgttttcacaacggttaaactgctccgaacagaacgtcaaaacatgattc
aagagccagagcagtatcacttcctgtatctagctgcat
BLASTn GenBank NR |
|
|
|
|
|
|
ACAAAGAGCGCGGAGCCTACATTGC |
688 |
109 |
6104 |
Antisense |
TACATTGCCACTCAAGCACCAACTA |
447 |
643 |
6121 |
Antisense |
GACAGCCGCAGATTTTTGGCGAGCA |
117 |
369 |
6150 |
Antisense |
GGAGCATAACAGCCCGATAATCGCC |
27 |
521 |
6180 |
Antisense |
GATAATCGCCATGCTGGTACGGACA |
266 |
421 |
6195 |
Antisense |
GAATGCTCGTCGTTGAGCCGATGGC |
435 |
331 |
6281 |
Antisense |
TAATACTCGCGAAGTCCGAACCGTT |
173 |
625 |
6357 |
Antisense |
GTGGCCTGATGTCGGAAAGCCGCAC |
153 |
493 |
6402 |
Antisense |
GTACACTGTTGCTCTGGAGCCGGAC |
106 |
461 |
6505 |
Antisense |
GAGCCAGAGCAGTATCACTTCCTGT |
416 |
385 |
6646 |
Antisense |
TATCACTTCCTGTATCTAGCTGCAT |
72 |
661 |
6658 |
Antisense | |
|
Affymetrix Proprietary Database |