|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
194078_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.3735
|
|
Exemplar sequence
|
|
D2085.1 NCBI
|
|
D2085.1 /REP_DB=WormBase Gene ID /WP=CE03105 /TR=Q18990 /GB=CAA91059.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation /DEF=glutamine-dependent carbamoyl-phosphate synthase, aspartate carbamoyltransferase, dihydroorotase
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_063437(11) |
|
|
|
|
|
NM_063437 NCBI |
Caenorhabditis elegans PYRimidine biosynthesis family member (pyr-1) (pyr-1) mRNA, complete cds. |
11/11 |
None |
SNAP00000003891 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:8651042:8658340:1 |
11/11 |
None |
GENEFINDER00000003897 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:8646250:8658340:1 |
11/11 |
None |
D2085.1 ENSEMBL |
cdna:known chromosome:CEL140:II:8651057:8658731:1 gene:D2085.1 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:8651053-8658337(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
glutamine-dependent carbamoyl-phosphate synthase, aspartate carbamoyltransferase, dihydroorotase
|
|
pyr-1
|
|
D2085.1
|
|
174385 Entrez gene
|
|
Q18990 EMBL-EBI
|
|
CE03105 Wormbase
|
Functional Annotations |
|
|
|
|
CANINE_2:CFAAFFX.8124.1.S1_S_AT |
similar to carbamoylphosphate synthetase 2/aspartate transcarbamylase/dihydroorotase |
cfa |
DROSGENOME1:151731_AT |
rudimentary |
dm |
DROSOPHILA_2:1641267_AT |
rudimentary |
dm |
DROSGENOME1:142945_AT |
rudimentary |
dm |
HG-U95AV2:749_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
hs |
HC-G110:749_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
hs |
HG-U95AV2:32031_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
hs |
HUGENEFL:D78586_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
hs |
HG-U133A:202715_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
hs |
HG-U133_PLUS_2:202715_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
hs |
HG-FOCUS:202715_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
hs |
HG-U133A_2:202715_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
hs |
U133_X3P:G4757895_3P_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
hs |
U133_X3P:HS2.377010.1.S1_3P_AT |
Carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
hs |
HG-U133_PLUS_2:1564084_AT |
Carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
hs |
HG-U95C:50353_AT |
Carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
hs |
MOUSE430_2:1452830_S_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
mm |
MOE430A:1452830_S_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
mm |
MOUSE430A_2:1452830_S_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
mm |
MU11KSUBA:AA466758_S_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
mm |
MG-U74AV2:96827_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
mm |
MG-U74BV2:110115_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
mm |
MG-U74AV2:161323_F_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
mm |
MOE430A:1452829_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
mm |
MOUSE430A_2:1452829_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
mm |
MOUSE430_2:1452829_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
mm |
MOE430B:1440857_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
mm |
MOUSE430_2:1440857_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
mm |
MG-U74BV2:116388_AT |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase |
mm |
MU19KSUBA:TC23434_AT |
Carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase (Cad), mRNA |
mm |
MU19KSUBC:TC35187_AT |
Carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase (Cad), mRNA |
mm |
RG-U34A:AB007768_AT |
carbamyl phosphatate synthetase 2 |
rn |
RG-U34B:RC_AI058913_AT |
carbamyl phosphatate synthetase 2 |
rn |
RAE230A:1371797_AT |
carbamyl phosphatate synthetase 2 |
rn |
RAT230_2:1371797_AT |
carbamyl phosphatate synthetase 2 |
rn |
RAE230A:1385437_AT |
carbamyl phosphatate synthetase 2 |
rn |
RAT230_2:1385437_AT |
carbamyl phosphatate synthetase 2 |
rn |
YEAST_2:1779682_AT |
Bifunctional carbamoylphosphate synthetase (CPSase)-aspartate transcarbamylase (ATCase), catalyzes the first two enzymatic steps in the de novo biosynthesis of pyrimidines; both activities are subject to feedback inhibition by UTP |
Sc | |
|
|
|
|
|
6207 |
'de novo' pyrimidine base biosynthesis |
inferred from electronic annotation |
QuickGO AmiGO |
6520 |
amino acid metabolism |
inferred from electronic annotation |
QuickGO AmiGO |
6526 |
arginine biosynthesis |
inferred from electronic annotation |
QuickGO AmiGO |
6807 |
nitrogen compound metabolism |
inferred from electronic annotation |
QuickGO AmiGO |
8152 |
metabolism |
inferred from electronic annotation |
QuickGO AmiGO |
9058 |
biosynthesis |
inferred from electronic annotation |
QuickGO AmiGO |
19856 |
pyrimidine base biosynthesis |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5737 |
cytoplasm |
inferred from electronic annotation |
QuickGO AmiGO |
9347 |
aspartate carbamoyltransferase complex |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
3824 |
catalytic activity |
inferred from electronic annotation |
QuickGO AmiGO |
4049 |
anthranilate synthase activity |
inferred from electronic annotation |
QuickGO AmiGO |
4086 |
carbamoyl-phosphate synthase activity |
inferred from electronic annotation |
QuickGO AmiGO |
5524 |
ATP binding |
inferred from electronic annotation |
QuickGO AmiGO |
16597 |
amino acid binding |
inferred from electronic annotation |
QuickGO AmiGO |
16743 |
carboxyl- and carbamoyltransferase activity |
inferred from electronic annotation |
QuickGO AmiGO |
16787 |
hydrolase activity |
inferred from electronic annotation |
QuickGO AmiGO |
16812 |
hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides |
inferred from electronic annotation |
QuickGO AmiGO |
16874 |
ligase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAA91059 |
Hypothetical protein D2085.1 [Caenorhabditis elegans] ref|NP_495838.1| PYRimidine biosynthesis family member (pyr-1) [Caenorhabditis elegans] |
0.0 |
blast |
CAE57538 |
Hypothetical protein CBG00515 [Caenorhabditis briggsae] |
0.0 |
blast |
AAW80263 |
carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase [Danio rerio] |
0.0 | |
|
|
|
|
|
Pfam |
IPR005481 EMBL-EBI |
Carbamoyl-phosphate synthetase large chain, N-terminal |
5.7E-58 |
Pfam |
IPR005481 EMBL-EBI |
Carbamoyl-phosphate synthetase large chain, N-terminal |
4.3E-11 |
Pfam |
IPR005479 EMBL-EBI |
Carbamoyl-phosphate synthase L chain, ATP-binding |
1.0E-126 |
Pfam |
IPR005479 EMBL-EBI |
Carbamoyl-phosphate synthase L chain, ATP-binding |
9.3E-11 |
Pfam |
IPR006132 EMBL-EBI |
Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain |
1.4E-69 |
Pfam |
IPR005480 EMBL-EBI |
Carbamoyl-phosphate synthetase large chain, oligomerisation |
7.0E-92 |
Pfam |
IPR002474 EMBL-EBI |
Carbamoyl-phosphate synthase, small chain |
2.4E-95 |
Pfam |
IPR006131 EMBL-EBI |
Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain |
1.2E-49 |
Pfam |
IPR006680 EMBL-EBI |
Amidohydrolase |
1.5E-7 |
Pfam |
IPR000991 EMBL-EBI |
Glutamine amidotransferase class-I |
7.2E-70 |
Pfam |
IPR004362 EMBL-EBI |
Methylglyoxal synthase-like domain |
5.2E-44 |
Pfam |
IPR005481 EMBL-EBI |
Carbamoyl-phosphate synthetase large chain, N-terminal |
5.7E-58 |
Pfam |
IPR005481 EMBL-EBI |
Carbamoyl-phosphate synthetase large chain, N-terminal |
4.3E-11 |
Pfam |
IPR005479 EMBL-EBI |
Carbamoyl-phosphate synthase L chain, ATP-binding |
1.0E-126 |
Pfam |
IPR005479 EMBL-EBI |
Carbamoyl-phosphate synthase L chain, ATP-binding |
9.3E-11 |
Pfam |
IPR006132 EMBL-EBI |
Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain |
1.4E-69 |
Pfam |
IPR005480 EMBL-EBI |
Carbamoyl-phosphate synthetase large chain, oligomerisation |
7.0E-92 |
Pfam |
IPR002474 EMBL-EBI |
Carbamoyl-phosphate synthase, small chain |
2.4E-95 |
Pfam |
IPR006131 EMBL-EBI |
Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain |
1.2E-49 |
Pfam |
IPR006680 EMBL-EBI |
Amidohydrolase |
1.5E-7 |
Pfam |
IPR000991 EMBL-EBI |
Glutamine amidotransferase class-I |
7.2E-70 |
Pfam |
IPR004362 EMBL-EBI |
Methylglyoxal synthase-like domain |
5.2E-44 |
Pfam |
IPR005481 EMBL-EBI |
Carbamoyl-phosphate synthetase large chain, N-terminal |
5.7E-58 |
Pfam |
IPR005481 EMBL-EBI |
Carbamoyl-phosphate synthetase large chain, N-terminal |
4.3E-11 |
Pfam |
IPR005479 EMBL-EBI |
Carbamoyl-phosphate synthase L chain, ATP-binding |
1.0E-126 |
Pfam |
IPR005479 EMBL-EBI |
Carbamoyl-phosphate synthase L chain, ATP-binding |
9.3E-11 |
Pfam |
IPR006132 EMBL-EBI |
Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain |
1.4E-69 |
Pfam |
IPR005480 EMBL-EBI |
Carbamoyl-phosphate synthetase large chain, oligomerisation |
7.0E-92 |
Pfam |
IPR002474 EMBL-EBI |
Carbamoyl-phosphate synthase, small chain |
2.4E-95 |
Pfam |
IPR006131 EMBL-EBI |
Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain |
1.2E-49 |
Pfam |
IPR006680 EMBL-EBI |
Amidohydrolase |
1.5E-7 |
Pfam |
IPR000991 EMBL-EBI |
Glutamine amidotransferase class-I |
7.2E-70 |
Pfam |
IPR004362 EMBL-EBI |
Methylglyoxal synthase-like domain |
5.2E-44 | |
Sequence |
|
>C. ELEGANS:194078_S_AT
agtttgcgatcaaccggtcatcaatggaggtgatggaactggtgaacatccaactcaagc
tcttctcgatgtgtacactattcgacaagaaatgggaacagtcaatggacttaccatcgc
tttggttggagatttgaagaatggaagaacggttcactcattggctaaacttttatgttt
gtataaggacatcacccttcactacgttgctccgagtaccgaacttgaaatgccacagga
agtcttggactacgtctcgtcgaagtcgaattttgttcagaagaagttcaccagtctggc
tgaaggaatcaatcatgtcgacgttgtctacgtgacaagaattcaaaaagaacgattctc
atctccagatgaatacaataaggtgaaaggaagctacgtaatcaatgcgaaacttctcaa
tgaggccgccagagatgtcgaggaaccatcgagtctgttggttccagctcgttctcttcc
aatcgtcatgcatccattgcctcgtgtggatgagattgctgttgaactggatcatgatga
aagagccgcctacttcagacaagcaaagaatggggtcttcgttcgtatgtctat
BLASTn GenBank NR |
|
|
|
|
|
|
AGTTTGCGATCAACCGGTCATCAAT |
509 |
63 |
5982 |
Antisense |
TCAAGCTCTTCTCGATGTGTACACT |
545 |
631 |
6036 |
Antisense |
GAAGAACGGTTCACTCATTGGCTAA |
88 |
333 |
6125 |
Antisense |
ATAAGGACATCACCCTTCACTACGT |
332 |
23 |
6164 |
Antisense |
TACGTTGCTCCGAGTACCGAACTTG |
534 |
303 |
6184 |
Antisense |
AAAGAACGATTCTCATCTCCAGATG |
443 |
123 |
6328 |
Antisense |
AGGCCGCCAGAGATGTCGAGGAACC |
435 |
53 |
6404 |
Antisense |
TCGAGTCTGTTGGTTCCAGCTCGTT |
436 |
603 |
6430 |
Antisense |
TTCCAATCGTCATGCATCCATTGCC |
587 |
701 |
6458 |
Antisense |
GATGAAAGAGCCGCCTACTTCAGAC |
342 |
411 |
6517 |
Antisense |
ATGGGGTCTTCGTTCGTATGTCTAT |
29 |
51 |
6551 |
Antisense | |
|
Affymetrix Proprietary Database | |