|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
194046_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.3696
|
|
Exemplar sequence
|
|
ZK1067.1 NCBI
|
|
ZK1067.1 /REP_DB=WormBase Gene ID /WP=CE25678 /GEN=let-23 /TR=SW:P24348 /GB=CAA93882.2 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation /DEF=tyrosine-protein kinase (Epidermal growth factor receptor subfamily)
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_063561(11) |
|
|
|
|
|
NM_063561 NCBI |
Caenorhabditis elegans LEThal family member (let-23) (let-23) mRNA, complete cds. |
11/11 |
None |
SNAP00000014740 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:9199100:9206849:1 |
11/11 |
None |
GENEFINDER00000014744 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:9197429:9206849:1 |
11/11 |
None |
ZK1067.1 ENSEMBL |
cdna:known chromosome:CEL140:II:9198179:9207119:1 gene:ZK1067.1 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:9197425-9206846(+) |
97.9 |
100.0 |
| |
Public Domain and Genome References |
|
tyrosine-protein kinase (Epidermal growth factor receptor subfamily)
|
|
let-23
|
|
ZK1067.1
|
|
174462 Entrez gene
|
|
CE03840 Wormbase
|
Functional Annotations |
|
|
|
|
|
|
|
6118 |
electron transport |
inferred from electronic annotation |
QuickGO AmiGO |
6468 |
protein amino acid phosphorylation |
inferred from electronic annotation |
QuickGO AmiGO |
7169 |
transmembrane receptor protein tyrosine kinase signaling pathway |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
16020 |
membrane |
inferred from electronic annotation |
QuickGO AmiGO |
16323 |
basolateral plasma membrane |
inferred from direct assay |
QuickGO AmiGO |
|
|
|
|
4672 |
protein kinase activity |
inferred from electronic annotation |
QuickGO AmiGO |
4674 |
protein serine/threonine kinase activity |
inferred from electronic annotation |
QuickGO AmiGO |
4713 |
protein-tyrosine kinase activity |
inferred from electronic annotation |
QuickGO AmiGO |
4714 |
transmembrane receptor protein tyrosine kinase activity |
inferred from electronic annotation |
QuickGO AmiGO |
5006 |
epidermal growth factor receptor activity |
inferred from electronic annotation |
QuickGO AmiGO |
5489 |
electron transporter activity |
inferred from electronic annotation |
QuickGO AmiGO |
5524 |
ATP binding |
inferred from electronic annotation |
QuickGO AmiGO |
20037 |
heme binding |
inferred from electronic annotation |
QuickGO AmiGO |
5006 |
epidermal growth factor receptor activity |
inferred from sequence similarity |
QuickGO AmiGO | |
|
|
|
|
|
blast |
BAA09729.1 |
receptor tyrosine kinase [Caenorhabditis elegans] |
0.0 |
blast |
CAA93882 |
Hypothetical protein ZK1067.1 [Caenorhabditis elegans] ref|NP_495962.2| LEThal family member (let-23) [Caenorhabditis elegans] pir||E88257 protein let-23 [imported] - Caenorhabditis elegans prf||1703413A Tyr kinase |
0.0 |
blast |
P24348 |
Let-23 receptor tyrosine-protein kinase precursor (Lethal protein 23) |
0.0 | |
|
|
|
|
|
Pfam |
IPR006211 EMBL-EBI |
Furin-like cysteine rich region |
2.2E-89 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
3.8E-57 |
Pfam |
IPR000494 EMBL-EBI |
Epidermal growth-factor receptor (EGFR), L domain |
4.1E-46 |
Pfam |
IPR000494 EMBL-EBI |
Epidermal growth-factor receptor (EGFR), L domain |
1.3E-38 |
Pfam |
IPR008627 EMBL-EBI |
GETHR pentapeptide |
3.3E-5 |
Pfam |
IPR008627 EMBL-EBI |
GETHR pentapeptide |
2.3E-5 |
Pfam |
IPR008627 EMBL-EBI |
GETHR pentapeptide |
2.9E-9 |
Pfam |
IPR008627 EMBL-EBI |
GETHR pentapeptide |
3.2E-9 |
Pfam |
IPR008627 EMBL-EBI |
GETHR pentapeptide |
3.2E-7 |
Pfam |
IPR008627 EMBL-EBI |
GETHR pentapeptide |
5.7E-9 |
Pfam |
IPR006211 EMBL-EBI |
Furin-like cysteine rich region |
2.2E-89 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
3.8E-57 |
Pfam |
IPR000494 EMBL-EBI |
Epidermal growth-factor receptor (EGFR), L domain |
4.1E-46 |
Pfam |
IPR000494 EMBL-EBI |
Epidermal growth-factor receptor (EGFR), L domain |
1.3E-38 |
Pfam |
IPR006211 EMBL-EBI |
Furin-like cysteine rich region |
2.2E-89 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
3.8E-57 |
Pfam |
IPR000494 EMBL-EBI |
Epidermal growth-factor receptor (EGFR), L domain |
4.1E-46 |
Pfam |
IPR000494 EMBL-EBI |
Epidermal growth-factor receptor (EGFR), L domain |
1.3E-38 |
NP_495962.2 |
2 |
7-29,819-841 |
ZK1067.1 |
2 |
7-29,819-841 |
SNAP00000014740 |
1 |
758-780 |
GENEFINDER00000014744 |
1 |
1033-1055 | |
Sequence |
|
>C. ELEGANS:194046_S_AT
gagcttctgagatgttggatggcggatccaaagtctcgtcctggttttgaaatattatat
gaaagatttaaagaattctgtaaggttccccaacttttcctggaaaattccaacaagatt
tctgaatctgatttgtcagctgaagaacgttttcaaacggaaagaatccgagaaatgttt
gatggaaatatcgatccacagatgtactttgatcaaggaagtttaccaagtatgccaagt
tctccaacttctatggcaacgttcacaattccacatggtgatctgatgaatcgaatgcaa
tcagtaaactcatctaggtacaaaacggagccttttgattatgggtcaaccgcacaggaa
gataattcatatcttattccaaaaaccaaagaagttcagcagtcagcagttttgtataca
gctgttacaaatgaagatggtcaaaccgagctatccccatcaaatggcgattactacaac
caaccaaacactccttcatcttcctctggatattacaatg
BLASTn GenBank NR |
|
|
|
|
|
|
GAGCTTCTGAGATGTTGGATGGCGG |
78 |
389 |
3499 |
Antisense |
GGATGGCGGATCCAAAGTCTCGTCC |
579 |
513 |
3515 |
Antisense |
AAGTCTCGTCCTGGTTTTGAAATAT |
29 |
157 |
3529 |
Antisense |
ATATCGATCCACAGATGTACTTTGA |
97 |
21 |
3686 |
Antisense |
GTATGCCAAGTTCTCCAACTTCTAT |
561 |
455 |
3728 |
Antisense |
CACAATTCCACATGGTGATCTGATG |
85 |
195 |
3762 |
Antisense |
TGGGTCAACCGCACAGGAAGATAAT |
6 |
553 |
3840 |
Antisense |
AGTTCAGCAGTCAGCAGTTTTGTAT |
507 |
63 |
3891 |
Antisense |
GCTATCCCCATCAAATGGCGATTAC |
249 |
303 |
3948 |
Antisense |
GATTACTACAACCAACCAAACACTC |
367 |
425 |
3967 |
Antisense |
TCATCTTCCTCTGGATATTACAATG |
167 |
621 |
3994 |
Antisense | |
|
Affymetrix Proprietary Database |