|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
194028_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.1313
|
|
Exemplar sequence
|
|
K02B12.1 NCBI
|
|
K02B12.1 /REP_DB=WormBase Gene ID /WP=CE28045 /GEN=ceh-6 /TR=SW:P20268 /GB=CAB00031.2 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation /DEF=Homeobox domain, Pou domain - N-terminal to homeobox domain
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_059903(11) |
|
|
|
|
|
NM_059903 NCBI |
Caenorhabditis elegans C.Elegans Homeobox family member (ceh-6) (ceh-6) mRNA, complete cds. |
11/11 |
None |
SNAP00000001140 ENSEMBL |
cdna:SNAP chromosome:CEL140:I:8506545:8508221:-1 |
11/11 |
None |
GENEFINDER00000001160 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:I:8506545:8510385:-1 |
11/11 |
None |
K02B12.1 ENSEMBL |
cdna:known chromosome:CEL140:I:8506239:8510468:-1 gene:K02B12.1 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:8506475-8508152(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
Homeobox domain, Pou domain - N-terminal to homeobox domain
|
|
ceh-6
|
|
K02B12.1
|
|
172640 Entrez gene
|
|
P20268 EMBL-EBI
|
|
CE28045 Wormbase
|
Functional Annotations |
|
|
|
|
HG-U133_PLUS_2:208563_X_AT |
POU domain, class 3, transcription factor 3 |
hs |
HG-U133A:208563_X_AT |
POU domain, class 3, transcription factor 3 |
hs |
HG-FOCUS:208563_X_AT |
POU domain, class 3, transcription factor 3 |
hs |
HG-U133A_2:208563_X_AT |
POU domain, class 3, transcription factor 3 |
hs |
U133_X3P:G5453935_3P_X_AT |
POU domain, class 3, transcription factor 3 |
hs |
U133_X3P:G5453935_3P_AT |
POU domain, class 3, transcription factor 3 |
hs |
HU35KSUBC:RC_N52158_AT |
POU domain, class 3, transcription factor 3 |
hs |
U133_X3P:HS.47448.0.A1_3P_AT |
POU domain, class 3, transcription factor 3 |
hs |
HG-U133_PLUS_2:228780_AT |
POU domain, class 3, transcription factor 3 |
hs |
HG-U133B:228780_AT |
POU domain, class 3, transcription factor 3 |
hs |
HG-U95B:46840_AT |
POU domain, class 3, transcription factor 3 |
hs |
HG-U95E:67864_AT |
POU domain, class 3, transcription factor 3 |
hs |
MOUSE430_2:1422331_AT |
POU domain, class 3, transcription factor 3 |
mm |
MOE430A:1422331_AT |
POU domain, class 3, transcription factor 3 |
mm |
MOUSE430A_2:1422331_AT |
POU domain, class 3, transcription factor 3 |
mm |
MU11KSUBB:MSA.1093.0_AT |
POU domain, class 3, transcription factor 3 |
mm |
MG-U74AV2:101305_AT |
POU domain, class 3, transcription factor 3 |
mm |
MG-U74BV2:163586_AT |
POU domain, class 3, transcription factor 3 (Pou3f3), mRNA |
mm |
MOE430B:1435197_AT |
POU domain, class 3, transcription factor 3 (Pou3f3), mRNA |
mm |
MOUSE430_2:1435197_AT |
POU domain, class 3, transcription factor 3 (Pou3f3), mRNA |
mm |
RN-U34:AJ001641_AT |
POU domain, class 3, transcription factor 3 |
rn |
RG-U34A:AJ001641_AT |
POU domain, class 3, transcription factor 3 |
rn |
RAE230A:1371043_A_AT |
POU domain, class 3, transcription factor 3 |
rn |
RAT230_2:1371043_A_AT |
POU domain, class 3, transcription factor 3 |
rn | |
|
|
|
|
|
6355 |
regulation of transcription, DNA-dependent |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5634 |
nucleus |
inferred from electronic annotation |
QuickGO AmiGO |
5634 |
nucleus |
inferred from direct assay |
QuickGO AmiGO |
5737 |
cytoplasm |
inferred from direct assay |
QuickGO AmiGO |
|
|
|
|
3677 |
DNA binding |
inferred from electronic annotation |
QuickGO AmiGO |
3700 |
transcription factor activity |
inferred from electronic annotation |
QuickGO AmiGO |
3700 |
transcription factor activity |
inferred from sequence similarity |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAB00031 |
Hypothetical protein K02B12.1 [Caenorhabditis elegans] ref|NP_492304.1| C.Elegans Homeobox family member (ceh-6) [Caenorhabditis elegans] gb|AAG10298.1| POU family III homeodomain protein CEH-6 [Caenorhabditis elegans] sp|P20268|HM06_CAEEL Homeobox protein ceh-6 |
0.0 |
blast |
T23218 |
hypothetical protein K02B12.1 - Caenorhabditis elegans |
0.0 |
blast |
T23218 |
hypothetical protein K02B12.1 - Caenorhabditis elegans |
1.0E-180 |
blast |
CAB00031 |
Hypothetical protein K02B12.1 [Caenorhabditis elegans] ref|NP_492304.1| C.Elegans Homeobox family member (ceh-6) [Caenorhabditis elegans] gb|AAG10298.1| POU family III homeodomain protein CEH-6 [Caenorhabditis elegans] sp|P20268|HM06_CAEEL Homeobox protein ceh-6 |
1.0E-180 |
blast |
CAE67117 |
Hypothetical protein CBG12531 [Caenorhabditis briggsae] |
1.0E-160 | |
|
|
|
|
|
scop |
a.4.1.Homeodomain |
All alpha proteins; DNA/RNA-binding 3-helical bundle; Homeodomain-like; Homeodomain |
7.00000015651189E-23 |
scop |
a.4.1.Homeodomain |
All alpha proteins; DNA/RNA-binding 3-helical bundle; Homeodomain-like; Homeodomain |
1.99999999963992E-23 |
Pfam |
IPR001356 EMBL-EBI |
Homeobox |
2.3E-21 |
Pfam |
IPR000327 EMBL-EBI |
POU domain |
4.3E-53 |
Pfam |
IPR001356 EMBL-EBI |
Homeobox |
2.3E-21 |
Pfam |
IPR000327 EMBL-EBI |
POU domain |
4.3E-53 | |
Sequence |
|
>C. ELEGANS:194028_S_AT
agctggtggaccacatcagccattatctgatatttccgatgatagtgaacagacgtgtcc
agatgatttggaaggatttgcaaaacaatttaagcagagaagaatcaaattaggatacac
acaagcagatgtaggtgtggctctcggaacactctacggaaatatattttcccagacaac
aatttgtcgttttgaagcgcttcaactctctttcaagaatatgtgcaaactaaagccact
tctattcaaatggctcgaggaagctgattcaacgactggctcgcccaattctacatttga
aaaaatgacagggcaagctggaagaaagagaaagaagagaacaagcattgaggtcaatgt
aaaatctcgtcttgaattccatttccagtcgaatcagaagccaaatgcacaagagattac
acaagttgccatggagttgcagcttgagaaagaggttgtccgtgtctggttctgcaatcg
tcgtcaaaaagagaagcgaatagctccaaatcaatacgatgctccacatccaatggcttt
aaacaatggatatccaatgactgctgaccttttcccatatcaagccgtcgtcaatca
BLASTn GenBank NR |
|
|
|
|
|
|
AGCTGGTGGACCACATCAGCCATTA |
284 |
81 |
363 |
Antisense |
TAGGTGTGGCTCTCGGAACACTCTA |
102 |
635 |
494 |
Antisense |
TTGAAGCGCTTCAACTCTCTTTCAA |
75 |
705 |
554 |
Antisense |
GCAAACTAAAGCCACTTCTATTCAA |
91 |
317 |
587 |
Antisense |
GAAGCTGATTCAACGACTGGCTCGC |
293 |
343 |
622 |
Antisense |
ATCTCGTCTTGAATTCCATTTCCAG |
398 |
33 |
726 |
Antisense |
GTTGCCATGGAGTTGCAGCTTGAGA |
158 |
441 |
787 |
Antisense |
GAAAGAGGTTGTCCGTGTCTGGTTC |
605 |
359 |
810 |
Antisense |
GATGCTCCACATCCAATGGCTTTAA |
539 |
413 |
880 |
Antisense |
GGATATCCAATGACTGCTGACCTTT |
683 |
507 |
910 |
Antisense |
TCCCATATCAAGCCGTCGTCAATCA |
219 |
599 |
935 |
Antisense | |
|
Affymetrix Proprietary Database |