|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
194015_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.1591
|
|
Exemplar sequence
|
|
ZK1151.1 NCBI
|
|
ZK1151.1 /REP_DB=WormBase Gene ID /WP=CE25734 /TR=O18290 /GB=CAB07724.2 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation /DEF=Src homology domain 3, Actinin-type actin-binding domain containing proteins
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001026683(11), NM_001026684(11), NM_001026688(11), NM_001026682(11), NM_001026686(11), NM_001026687(11), NM_001026685(11) |
|
|
|
|
|
NM_001026683 NCBI |
Caenorhabditis elegans Variable ABnormal morphology family member (vab-10) (vab-10) mRNA, complete cds. |
11/11 |
None |
NM_001026684 NCBI |
Caenorhabditis elegans Variable ABnormal morphology family member (vab-10) (vab-10) mRNA, complete cds. |
11/11 |
None |
NM_001026688 NCBI |
Caenorhabditis elegans Variable ABnormal morphology family member (vab-10) (vab-10) mRNA, complete cds. |
11/11 |
None |
NM_001026682 NCBI |
Caenorhabditis elegans Variable ABnormal morphology family member (vab-10) (vab-10) mRNA, complete cds. |
11/11 |
None |
NM_001026686 NCBI |
Caenorhabditis elegans Variable ABnormal morphology family member (vab-10) (vab-10) mRNA, complete cds. |
11/11 |
None |
NM_001026687 NCBI |
Caenorhabditis elegans Variable ABnormal morphology family member (vab-10) (vab-10) mRNA, complete cds. |
11/11 |
None |
NM_001026685 NCBI |
Caenorhabditis elegans Variable ABnormal morphology family member (vab-10) (vab-10) mRNA, complete cds. |
11/11 |
None |
ZK1151.1b ENSEMBL |
cdna:known chromosome:CEL140:I:11755550:11800240:-1 gene:ZK1151.1 |
11/11 |
A |
ZK1151.1c ENSEMBL |
cdna:known chromosome:CEL140:I:11755565:11800188:-1 gene:ZK1151.1 |
11/11 |
A |
ZK1151.1g ENSEMBL |
cdna:known chromosome:CEL140:I:11755884:11800188:-1 gene:ZK1151.1 |
11/11 |
A |
ZK1151.1a ENSEMBL |
cdna:known chromosome:CEL140:I:11772417:11800240:-1 gene:ZK1151.1 |
11/11 |
A |
ZK1151.1e ENSEMBL |
cdna:known chromosome:CEL140:I:11772438:11800188:-1 gene:ZK1151.1 |
11/11 |
A |
ZK1151.1d ENSEMBL |
cdna:known chromosome:CEL140:I:11772959:11800188:-1 gene:ZK1151.1 |
11/11 |
A |
ZK1151.1f ENSEMBL |
cdna:known chromosome:CEL140:I:11772959:11800188:-1 gene:ZK1151.1 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:11782184-11797515(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
ZK1151.1
|
Functional Annotations |
|
|
|
|
|
blast |
CAD90183 |
Hypothetical protein ZK1151.1b [Caenorhabditis elegans] emb|CAD90187.2| Hypothetical protein ZK1151.1b [Caenorhabditis elegans] emb|CAD90176.2| Hypothetical protein ZK1151.1b [Caenorhabditis elegans] emb|CAD44324.1| VAB-10B protein [Caenorhabditis elegans] ref|NP_001021854.1| Variable ABnormal morphology family member (vab-10) [Caenorhabditis elegans] |
0.0 |
blast |
CAD90184 |
Hypothetical protein ZK1151.1c [Caenorhabditis elegans] emb|CAD90188.2| Hypothetical protein ZK1151.1c [Caenorhabditis elegans] emb|CAD90177.2| Hypothetical protein ZK1151.1c [Caenorhabditis elegans] ref|NP_001021855.1| Variable ABnormal morphology family member (vab-10) [Caenorhabditis elegans] |
0.0 |
blast |
CAD44516 |
VAB-10B protein [Caenorhabditis elegans] |
0.0 |
blast |
CAH04759 |
Hypothetical protein ZK1151.1g [Caenorhabditis elegans] emb|CAH04743.1| Hypothetical protein ZK1151.1g [Caenorhabditis elegans] emb|CAH04711.1| Hypothetical protein ZK1151.1g [Caenorhabditis elegans] ref|NP_001021859.1| Variable ABnormal morphology family member (vab-10) [Caenorhabditis elegans] |
0.0 |
blast |
T26964 |
hypothetical protein ZK1151.2b - Caenorhabditis elegans |
0.0 |
blast |
CAH04740 |
Hypothetical protein ZK1151.1d [Caenorhabditis elegans] emb|CAH04708.1| Hypothetical protein ZK1151.1d [Caenorhabditis elegans] ref|NP_001021856.1| Variable ABnormal morphology family member (vab-10) [Caenorhabditis elegans] |
0.0 | |
|
|
Sequence |
|
>C. ELEGANS:194015_AT
aacaggaatgttgcacttctccgtcaacacgtctcgagaacccgtattaacgagggacac
catcctgacgttgacgccatcgaagacgaggtgcaaaagctgaatgtccgctgggaaaat
gtgaactcccaaatagcttctcgcttgctcgccgtcgaaagtgccctccaaatccaaatg
gtctaccgatccgagtacgagactgaaatgtcgtggttggacactgtcgaggagacgatc
aatcgtctgagaaagccagaagagctccgccctgagcaataccaacagcaactcgacatg
ctcatcgccgaatacacaaaccttcaagagcacactcaagcgattgagcacgtgaacaag
gagggtggtcggttcattcatgaagccaagattttcgacgcgaaactcggacagtactct
gatggaattgttggaatccacggacccggtatcaagtcggaattccgtcgtactaagcca
BLASTn GenBank NR |
|
|
|
|
|
|
AACAGGAATGTTGCACTTCTCCGTC |
17 |
137 |
3604 |
Antisense |
TCAACACGTCTCGAGAACCCGTATT |
590 |
629 |
3627 |
Antisense |
TTAACGAGGGACACCATCCTGACGT |
607 |
637 |
3650 |
Antisense |
ATCCTGACGTTGACGCCATCGAAGA |
88 |
39 |
3665 |
Antisense |
TGTGAACTCCCAAATAGCTTCTCGC |
238 |
557 |
3723 |
Antisense |
ATCCAAATGGTCTACCGATCCGAGT |
659 |
37 |
3775 |
Antisense |
TCCGCCCTGAGCAATACCAACAGCA |
701 |
595 |
3869 |
Antisense |
TCGACATGCTCATCGCCGAATACAC |
318 |
601 |
3896 |
Antisense |
CAAGGAGGGTGGTCGGTTCATTCAT |
595 |
183 |
3960 |
Antisense |
TGTTGGAATCCACGGACCCGGTATC |
681 |
561 |
4032 |
Antisense |
GTCGGAATTCCGTCGTACTAAGCCA |
36 |
471 |
4059 |
Antisense | |
|
Affymetrix Proprietary Database |