|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
193923_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.3598
|
|
Exemplar sequence
|
|
F42A8.2 NCBI
|
|
F42A8.2 /REP_DB=WormBase Gene ID /WP=CE01579 /TR=SW:Q09545 /GB=CAA87780.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation /DEF=succinate dehydrogenase (ubiquinone) iron sulphur protein
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq,GenBank identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_063591(11), AB008569(11) |
|
|
|
|
|
NM_063591 NCBI |
Caenorhabditis elegans Temporarily Assigned Gene name family member (tag-55) (tag-55) mRNA, complete cds. |
11/11 |
A |
AB008569 NCBI |
Caenorhabditis elegans mRNA for iron-sulfur subunit of mitochondrial succinate dehydrogenase, complete cds. |
11/11 |
None |
SNAP00000044379 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:9350782:9352643:-1 |
11/11 |
None |
GENEFINDER00000044386 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:9350782:9352643:-1 |
11/11 |
None |
F42A8.2.3 ENSEMBL |
cdna:known chromosome:CEL140:II:9350568:9352643:-1 gene:F42A8.2 |
11/11 |
None |
F42A8.2.1 ENSEMBL |
cdna:known chromosome:CEL140:II:9350615:9352643:-1 gene:F42A8.2 |
11/11 |
A |
F42A8.2.2 ENSEMBL |
cdna:known chromosome:CEL140:II:9350615:9352709:-1 gene:F42A8.2 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:9350778-9352640(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
succinate dehydrogenase (ubiquinone) iron sulphur protein
|
|
tag-55
|
|
F42A8.2
|
|
174482 Entrez gene
|
|
Q09545 EMBL-EBI
|
|
CE01579 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:249343_AT |
succinate dehydrogenase, iron-sulphur subunit, mitochondrial (SDH2-2) |
at |
CANINE:1584695_AT |
similar to Succinate dehydrogenase [ubiquinone] iron-sulfur protein, mitochondrial precursor (Ip) (Iron-sulfur subunit of complex II) |
cfa |
CANINE_2:CFAAFFX.24257.1.S1_S_AT |
similar to Succinate dehydrogenase [ubiquinone] iron-sulfur protein, mitochondrial precursor (Ip) (Iron-sulfur subunit of complex II) |
cfa |
CANINE_2:CFAAFFX.3371.1.S1_S_AT |
similar to Succinate dehydrogenase [ubiquinone] iron-sulfur protein, mitochondrial precursor (Ip) (Iron-sulfur subunit of complex II) |
cfa |
DROSOPHILA_2:1640632_AT |
Succinate dehydrogenase B |
dm |
DROSGENOME1:154195_AT |
Succinate dehydrogenase B |
dm |
HG-U133_PLUS_2:202675_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) |
hs |
HG-U133A:202675_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) |
hs |
HG-FOCUS:202675_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) |
hs |
HG-U133A_2:202675_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) |
hs |
HUGENEFL:U17886_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) |
hs |
U133_X3P:G9257241_3P_S_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) |
hs |
U133_X3P:HS.64.1.S1_3P_X_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) |
hs |
U133_X3P:HS.64.1.S1_3P_S_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) |
hs |
U133_X3P:202675_3P_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) |
hs |
HG-U133A_2:214166_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) |
hs |
HG-U133_PLUS_2:214166_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) |
hs |
HG-U133A:214166_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) |
hs |
HG-U95AV2:35751_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) |
hs |
MU11KSUBA:AA245912_F_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) |
mm |
MG-U74AV2:95053_S_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) |
mm |
MG-U74BV2:164293_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) |
mm |
MOE430A:1418005_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) |
mm |
MOUSE430A_2:1418005_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) |
mm |
MOUSE430_2:1418005_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) |
mm |
MU19KSUBA:TC22985_F_AT |
Succinate dehydrogenase complex, subunit B, iron sulfur (Ip), mRNA (cDNA clone MGC:19177 IMAGE:4225025) |
mm |
MU19KSUBA:TC22985_I_AT |
Succinate dehydrogenase complex, subunit B, iron sulfur (Ip), mRNA (cDNA clone MGC:19177 IMAGE:4225025) |
mm |
MU19KSUBC:TC36260_AT |
Succinate dehydrogenase complex, subunit B, iron sulfur (Ip), mRNA (cDNA clone MGC:19177 IMAGE:4225025) |
mm |
MU19KSUBC:TC36271_AT |
Succinate dehydrogenase complex, subunit B, iron sulfur (Ip), mRNA (cDNA clone MGC:19177 IMAGE:4225025) |
mm |
RG-U34C:RC_AI172320_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) (predicted) |
rn |
RAE230A:1372123_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) (predicted) |
rn |
RAT230_2:1372123_AT |
succinate dehydrogenase complex, subunit B, iron sulfur (Ip) (predicted) |
rn |
YEAST_2:1777010_AT |
Iron-sulfur protein subunit of succinate dehydrogenase (Sdh1p, Sdh2p, Sdh3p, Sdh4p), which couples the oxidation of succinate to the transfer of electrons to ubiquinone |
Sc | |
|
|
|
|
|
6099 |
tricarboxylic acid cycle |
inferred from electronic annotation |
QuickGO AmiGO |
6118 |
electron transport |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5489 |
electron transporter activity |
inferred from electronic annotation |
QuickGO AmiGO |
5506 |
iron ion binding |
inferred from electronic annotation |
QuickGO AmiGO |
16491 |
oxidoreductase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAA87780 |
Hypothetical protein F42A8.2 [Caenorhabditis elegans] ref|NP_495992.1| Temporarily Assigned Gene name family member (tag-55) [Caenorhabditis elegans] sp|Q09545|DHSB_CAEEL Putative succinate dehydrogenase [ubiquinone] iron-sulfur protein, mitochondrial precursor (IP) (IP subunit of complex II) |
1.0E-165 |
blast |
BAA23717.1 |
iron-sulfur subunit of mitochondrial succinate dehydrogenase [Caenorhabditis elegans] |
1.0E-157 |
blast |
CAA87780 |
Hypothetical protein F42A8.2 [Caenorhabditis elegans] ref|NP_495992.1| Temporarily Assigned Gene name family member (tag-55) [Caenorhabditis elegans] sp|Q09545|DHSB_CAEEL Putative succinate dehydrogenase [ubiquinone] iron-sulfur protein, mitochondrial precursor (IP) (IP subunit of complex II) |
1.0E-157 | |
|
|
Sequence |
|
>C. ELEGANS:193923_S_AT
gaggtcgatccaactttgactttcagaagaagttgtcgtgaaggaatctgtggatcctgt
gccatgaacatcggaggtcaaaacactttggcttgcatctgcaaaatcgattcggatacc
tcaaagagcaccaaaatctacccacttccacatatgttcgttgtgaaggaccttgtccca
gatatgaacctcttctacgctcaatatgcctctattcaaccatggattcaaaagaagacc
ccattgactcttggagaaaagcagatgcaccaaagtgtggctgaacgtgatcgtcttgat
ggtctctacgagtgtattctctgtgcttgctgctccacgtcatgcccatcctactggtgg
aatgctgataagtacctcggtccagctgttctcatgcaagcctacagatgggtcatcgat
tctcgtgatgactacgccaccgaacgccttcaccgtatgcacgactctttctcagctttc
aagtgccacaccatcatgaattgcacaaagacatgcccaaaacacttgaacccagctaag
gccatcggagagatcaaatcgctgcttactggattcacatc
BLASTn GenBank NR |
|
|
|
|
|
|
GAGGTCGATCCAACTTTGACTTTCA |
358 |
397 |
298 |
Antisense |
GATCCAACTTTGACTTTCAGAAGAA |
271 |
415 |
304 |
Antisense |
GAAGTTGTCGTGAAGGAATCTGTGG |
511 |
337 |
326 |
Antisense |
ATCTGTGGATCCTGTGCCATGAACA |
70 |
35 |
343 |
Antisense |
GATCCTGTGCCATGAACATCGGAGG |
40 |
415 |
350 |
Antisense |
TTTCAAGTGCCACACCATCATGAAT |
701 |
671 |
774 |
Antisense |
GCCACACCATCATGAATTGCACAAA |
425 |
279 |
782 |
Antisense |
TGAATTGCACAAAGACATGCCCAAA |
277 |
577 |
794 |
Antisense |
TGAACCCAGCTAAGGCCATCGGAGA |
659 |
573 |
824 |
Antisense |
GCCATCGGAGAGATCAAATCGCTGC |
636 |
279 |
838 |
Antisense |
AATCGCTGCTTACTGGATTCACATC |
28 |
169 |
854 |
Antisense | |
|
Affymetrix Proprietary Database | |