|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
193917_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.3818
|
|
Exemplar sequence
|
|
T01E8.3 NCBI
|
|
T01E8.3 /REP_DB=WormBase Gene ID /WP=CE02307 /TR=Q22070 /GB=CAA88745.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation /DEF=1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_063804(11) |
|
|
|
|
|
NM_063804 NCBI |
Caenorhabditis elegans PhosphoLipase C family member (plc-3) (plc-3) mRNA, complete cds. |
11/11 |
None |
SNAP00000042900 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:10222788:10228977:1 |
11/11 |
None |
GENEFINDER00000042908 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:10222788:10228977:1 |
11/11 |
None |
T01E8.3 ENSEMBL |
cdna:known chromosome:CEL140:II:10222788:10229347:1 gene:T01E8.3 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:10222784-10228974(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase
|
|
plc-3
|
|
T01E8.3
|
|
174586 Entrez gene
|
|
Q22070 EMBL-EBI
|
|
CE02307 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:251768_AT |
phosphoinositide-specific phospholipase C, putative |
at |
CANINE_2:CFAAFFX.14355.1.S1_AT |
similar to 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase gamma 1 (Phosphoinositide phospholipase C) (PLC-gamma-1) (Phospholipase C-gamma-1) (PLC-II) (PLC-148) |
cfa |
CANINE_2:CFAAFFX.14355.1.S1_S_AT |
similar to 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase gamma 1 (Phosphoinositide phospholipase C) (PLC-gamma-1) (Phospholipase C-gamma-1) (PLC-II) (PLC-148) |
cfa |
DROSOPHILA_2:1628815_AT |
small wing |
dm |
DROSGENOME1:153466_AT |
small wing |
dm |
CHICKEN:GGA.2589.1.S1_AT |
similar to 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase gamma 1 (Phosphoinositide phospholipase C) (PLC-gamma-1) (Phospholipase C-gamma-1) (PLC-II) (PLC-148) |
gga |
CHICKEN:GGA.2589.2.S1_X_AT |
similar to 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase gamma 1 (Phosphoinositide phospholipase C) (PLC-gamma-1) (Phospholipase C-gamma-1) (PLC-II) (PLC-148) |
gga |
CHICKEN:GGA.2589.3.S1_AT |
similar to 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase gamma 1 (Phosphoinositide phospholipase C) (PLC-gamma-1) (Phospholipase C-gamma-1) (PLC-II) (PLC-148) |
gga |
CHICKEN:GGA.2589.3.S1_X_AT |
similar to 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase gamma 1 (Phosphoinositide phospholipase C) (PLC-gamma-1) (Phospholipase C-gamma-1) (PLC-II) (PLC-148) |
gga |
CHICKEN:GGAAFFX.25967.2.S1_S_AT |
similar to 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase gamma 1 (Phosphoinositide phospholipase C) (PLC-gamma-1) (Phospholipase C-gamma-1) (PLC-II) (PLC-148) |
gga |
HG-U95AV2:34351_AT |
phospholipase C, gamma 1 |
hs |
HG-U95AV2:1082_AT |
phospholipase C, gamma 1 |
hs |
HC-G110:1082_AT |
phospholipase C, gamma 1 |
hs |
HG-U133_PLUS_2:216551_X_AT |
phospholipase C, gamma 1 |
hs |
HG-U133A_2:216551_X_AT |
phospholipase C, gamma 1 |
hs |
HG-U133A:216551_X_AT |
phospholipase C, gamma 1 |
hs |
HU35KSUBA:AA442054_S_AT |
phospholipase C, gamma 1 |
hs |
HUGENEFL:M34667_AT |
phospholipase C, gamma 1 |
hs |
U133_X3P:HS.268177.1.S1_3P_A_AT |
phospholipase C, gamma 1 |
hs |
U133_X3P:HS.268177.0.S2_3P_AT |
phospholipase C, gamma 1 |
hs |
HG-U133A_2:202789_AT |
phospholipase C, gamma 1 |
hs |
HG-FOCUS:202789_AT |
phospholipase C, gamma 1 |
hs |
HG-U133_PLUS_2:202789_AT |
phospholipase C, gamma 1 |
hs |
HG-U133A:202789_AT |
phospholipase C, gamma 1 |
hs |
MOE430A:1450360_AT |
phospholipase C, gamma 1 |
mm |
MOUSE430_2:1450360_AT |
phospholipase C, gamma 1 |
mm |
MOUSE430A_2:1450360_AT |
phospholipase C, gamma 1 |
mm |
MOE430B:1435149_AT |
phospholipase C, gamma 1 |
mm |
MOUSE430_2:1435149_AT |
phospholipase C, gamma 1 |
mm |
MU11KSUBB:MSA.15085.0_S_AT |
phospholipase C, gamma 1 |
mm |
MG-U74AV2:98290_AT |
phospholipase C, gamma 1 |
mm |
MG-U74BV2:107396_AT |
Phospholipase C, gamma 1 (Plcg1), mRNA |
mm |
MOUSE430_2:1442963_AT |
Phospholipase C, gamma 1 (Plcg1), mRNA |
mm |
MOE430B:1442963_AT |
Phospholipase C, gamma 1 (Plcg1), mRNA |
mm |
RG-U34A:J03806_AT |
phospholipase C, gamma 1 |
rn |
RAE230A:1368183_AT |
phospholipase C, gamma 1 |
rn |
RAT230_2:1368183_AT |
phospholipase C, gamma 1 |
rn |
RG-U34B:RC_AA943027_AT |
Phospholipase C, gamma 1 |
rn | |
|
|
|
|
|
6629 |
lipid metabolism |
inferred from electronic annotation |
QuickGO AmiGO |
7165 |
signal transduction |
inferred from electronic annotation |
QuickGO AmiGO |
7242 |
intracellular signaling cascade |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
4435 |
phosphoinositide phospholipase C activity |
inferred from electronic annotation |
QuickGO AmiGO |
4629 |
phospholipase C activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAA88745 |
Hypothetical protein T01E8.3 [Caenorhabditis elegans] ref|NP_496205.1| PhosphoLipase C family member (plc-3) [Caenorhabditis elegans] |
0.0 |
blast |
CAE71733 |
Hypothetical protein CBG18715 [Caenorhabditis briggsae] |
0.0 |
blast |
XP_624101 |
PREDICTED: similar to ENSANGP00000022029 [Apis mellifera] |
0.0 | |
|
|
|
|
|
Pfam |
IPR000980 EMBL-EBI |
SH2 motif |
1.6E-25 |
Pfam |
IPR000980 EMBL-EBI |
SH2 motif |
3.2E-21 |
Pfam |
IPR000909 EMBL-EBI |
Phosphatidylinositol-specific phospholipase C, X domain |
1.2E-71 |
Pfam |
IPR001452 EMBL-EBI |
SH3 |
6.1E-8 |
Pfam |
IPR001711 EMBL-EBI |
Phosphatidylinositol-specific phospholipase C, Y domain |
3.4E-45 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
4.6E-29 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
4.2E-10 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
3.3E-12 |
Pfam |
IPR000980 EMBL-EBI |
SH2 motif |
1.6E-25 |
Pfam |
IPR000980 EMBL-EBI |
SH2 motif |
3.2E-21 |
Pfam |
IPR000909 EMBL-EBI |
Phosphatidylinositol-specific phospholipase C, X domain |
1.2E-71 |
Pfam |
IPR001452 EMBL-EBI |
SH3 |
6.1E-8 |
Pfam |
IPR001711 EMBL-EBI |
Phosphatidylinositol-specific phospholipase C, Y domain |
3.4E-45 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
4.6E-29 |
NP_496205.1 |
1 |
142-161 |
T01E8.3 |
1 |
142-161 | |
Sequence |
|
>C. ELEGANS:193917_AT
ttgagatccagtgtcccgaagtagcactgatcagattccacgtggaagacggtgactttg
tgggaccaaaaacagatccgttcattggtcaagcagtattccctgttgattcaattagat
gtggattccgatcagttccactcaaaaatcagtacagtgaggagcttgagctctcttcac
tgttagttgatgtacaaatgtgctccagagaaggaactcaattgatcaggtcgtcgtcgc
atttcttgcaggcgagtcgtctggctcctgtcttcgctcaccgtaagatcacaaatggcg
atagtatccctcgtgagatggcacctcggttacgaacatcagccaccgatcgttcactag
actctccaacaaattccgagtcaagagccactcttctgagcggccaacgaggtagccaag
actctatggacagcgctgccgaaacatcgtcc
BLASTn GenBank NR |
|
|
|
|
|
|
TTGAGATCCAGTGTCCCGAAGTAGC |
112 |
703 |
3371 |
Antisense |
TGGATTCCGATCAGTTCCACTCAAA |
206 |
551 |
3492 |
Antisense |
TGAGCTCTCTTCACTGTTAGTTGAT |
82 |
569 |
3537 |
Antisense |
ACTCAATTGATCAGGTCGTCGTCGC |
291 |
99 |
3586 |
Antisense |
TCGTCGTCGCATTTCTTGCAGGCGA |
463 |
605 |
3601 |
Antisense |
TGTCTTCGCTCACCGTAAGATCACA |
595 |
557 |
3639 |
Antisense |
TAGTATCCCTCGTGAGATGGCACCT |
533 |
651 |
3672 |
Antisense |
GGCACCTCGGTTACGAACATCAGCC |
608 |
535 |
3690 |
Antisense |
CACTAGACTCTCCAACAAATTCCGA |
271 |
191 |
3725 |
Antisense |
TCTTCTGAGCGGCCAACGAGGTAGC |
473 |
615 |
3762 |
Antisense |
GGACAGCGCTGCCGAAACATCGTCC |
387 |
525 |
3798 |
Antisense | |
|
Affymetrix Proprietary Database |