|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
193739_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.2943
|
|
Exemplar sequence
|
|
Y48E1B.3 NCBI
|
|
Y48E1B.3 /REP_DB=WormBase Gene ID /WP=CE22159 /GEN=csp-1 /TR=O18197 /GB=CAB07699.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation /DEF=geranylgeranyl transferase beta subunit
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_064447(11) |
|
|
|
|
|
NM_064447 NCBI |
Caenorhabditis elegans Y48E1B.3 (Y48E1B.3) mRNA, complete cds. |
11/11 |
A |
SNAP00000010059 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:13533528:13585325:-1 |
11/11 |
None |
GENEFINDER00000010072 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:13547831:13553380:-1 |
11/11 |
None |
Y48E1B.3 ENSEMBL |
cdna:known chromosome:CEL140:II:13547660:13567867:-1 gene:Y48E1B.3 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:13547827-13567859(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
geranylgeranyl transferase beta subunit
|
|
Y48E1B.3
|
|
174999 Entrez gene
|
|
O18197 EMBL-EBI
|
|
CE22159 Wormbase
|
Functional Annotations |
|
|
|
|
ATGENOME1:19828_AT |
geranylgeranyl transferase type I beta subunit (GGT-IB) |
at |
ATH1-121501:266985_AT |
geranylgeranyl transferase type I beta subunit (GGT-IB) |
at |
CANINE_2:CFAAFFX.1287.1.S1_AT |
similar to protein geranylgeranyltransferase type I, beta subunit |
cfa |
DROSOPHILA_2:1623853_AT |
subunit of type I geranylgeranyl transferase |
dm |
DROSGENOME1:143774_AT |
subunit of type I geranylgeranyl transferase |
dm |
HG-U95AV2:1275_AT |
protein geranylgeranyltransferase type I, beta subunit |
hs |
HC-G110:1275_AT |
protein geranylgeranyltransferase type I, beta subunit |
hs |
HG-U133_PLUS_2:206288_AT |
protein geranylgeranyltransferase type I, beta subunit |
hs |
HG-U133A:206288_AT |
protein geranylgeranyltransferase type I, beta subunit |
hs |
HG-FOCUS:206288_AT |
protein geranylgeranyltransferase type I, beta subunit |
hs |
HG-U133A_2:206288_AT |
protein geranylgeranyltransferase type I, beta subunit |
hs |
HUGENEFL:L25441_AT |
protein geranylgeranyltransferase type I, beta subunit |
hs |
U133_X3P:G4826899_3P_AT |
protein geranylgeranyltransferase type I, beta subunit |
hs |
MG-U74BV2:115249_AT |
protein geranylgeranyltransferase type I, beta subunit |
mm |
MG-U74BV2:113270_AT |
protein geranylgeranyltransferase type I, beta subunit |
mm |
MG-U74BV2:113271_AT |
protein geranylgeranyltransferase type I, beta subunit |
mm |
MOE430B:1429770_AT |
protein geranylgeranyltransferase type I, beta subunit |
mm |
MOUSE430_2:1429770_AT |
protein geranylgeranyltransferase type I, beta subunit |
mm |
MOE430B:1429769_AT |
protein geranylgeranyltransferase type I, beta subunit |
mm |
MOUSE430_2:1429769_AT |
protein geranylgeranyltransferase type I, beta subunit |
mm |
MOE430B:1438229_AT |
protein geranylgeranyltransferase type I, beta subunit |
mm |
MOUSE430_2:1438229_AT |
protein geranylgeranyltransferase type I, beta subunit |
mm |
MOE430B:1438230_AT |
protein geranylgeranyltransferase type I, beta subunit |
mm |
MOUSE430_2:1438230_AT |
protein geranylgeranyltransferase type I, beta subunit |
mm |
MG-U74CV2:170736_AT |
protein geranylgeranyltransferase type I, beta subunit |
mm |
MG-U74CV2:168952_I_AT |
Protein geranylgeranyltransferase type I, beta subunit (Pggt1b), mRNA |
mm |
MU19KSUBC:TC38632_AT |
Protein geranylgeranyltransferase type I, beta subunit (Pggt1b), mRNA |
mm |
RG-U34A:RC_AI235344_AT |
protein geranylgeranyltransferase type I, beta subunit |
rn |
RAE230A:1369285_AT |
protein geranylgeranyltransferase type I, beta subunit |
rn |
RAT230_2:1369285_AT |
protein geranylgeranyltransferase type I, beta subunit |
rn | |
|
|
|
|
|
3824 |
catalytic activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAB07699 |
Hypothetical protein Y48E1B.3 [Caenorhabditis elegans] ref|NP_496848.1| Y48E1B.3 [Caenorhabditis elegans] |
0.0 |
blast |
CAB07689 |
Hypothetical protein Y48E1B.2a [Caenorhabditis elegans] ref|NP_496845.1| Y48E1B.2a [Caenorhabditis elegans] |
0.0 |
blast |
CAE73333 |
Hypothetical protein CBG20762 [Caenorhabditis briggsae] |
0.0 |
blast |
CAB07690 |
Hypothetical protein Y48E1B.4 [Caenorhabditis elegans] ref|NP_496849.1| Y48E1B.4 [Caenorhabditis elegans] |
0.0 |
blast |
CAE73330 |
Hypothetical protein CBG20759 [Caenorhabditis briggsae] |
1.0E-177 |
blast |
CAB07699 |
Hypothetical protein Y48E1B.3 [Caenorhabditis elegans] ref|NP_496848.1| Y48E1B.3 [Caenorhabditis elegans] |
1.0E-150 |
blast |
CAE73330 |
Hypothetical protein CBG20759 [Caenorhabditis briggsae] |
1.0E-132 |
blast |
XP_538560 |
PREDICTED: similar to protein geranylgeranyltransferase type I, beta subunit isoform 1 [Canis familiaris] |
2.0E-66 | |
|
|
|
|
|
Pfam |
IPR001330 EMBL-EBI |
Prenyltransferase/squalene oxidase |
0.015 |
Pfam |
IPR001330 EMBL-EBI |
Prenyltransferase/squalene oxidase |
0.011 |
Pfam |
IPR001330 EMBL-EBI |
Prenyltransferase/squalene oxidase |
5.2E-9 |
Pfam |
IPR001330 EMBL-EBI |
Prenyltransferase/squalene oxidase |
7.8E-4 |
Pfam |
IPR001330 EMBL-EBI |
Prenyltransferase/squalene oxidase |
0.049 |
Pfam |
IPR001330 EMBL-EBI |
Prenyltransferase/squalene oxidase |
0.015 |
Pfam |
IPR001330 EMBL-EBI |
Prenyltransferase/squalene oxidase |
0.011 |
Pfam |
IPR001330 EMBL-EBI |
Prenyltransferase/squalene oxidase |
5.2E-9 |
Pfam |
IPR001330 EMBL-EBI |
Prenyltransferase/squalene oxidase |
7.8E-4 |
Pfam |
IPR001330 EMBL-EBI |
Prenyltransferase/squalene oxidase |
0.0096 |
Pfam |
IPR001330 EMBL-EBI |
Prenyltransferase/squalene oxidase |
0.0056 |
Pfam |
IPR001330 EMBL-EBI |
Prenyltransferase/squalene oxidase |
0.011 |
Pfam |
IPR001330 EMBL-EBI |
Prenyltransferase/squalene oxidase |
5.2E-9 |
Pfam |
IPR001330 EMBL-EBI |
Prenyltransferase/squalene oxidase |
7.8E-4 |
Pfam |
IPR001330 EMBL-EBI |
Prenyltransferase/squalene oxidase |
8.5E-8 |
SNAP00000010059 |
2 |
1554-1576,1588-1610 | |
Sequence |
|
>C. ELEGANS:193739_S_AT
atgtttctggagtcaaggcgtcggctcggaatcggacatgcgattcgtattctgtgcagt
agccatcagccatattctcgacggagacaaagagcaaacaatcgactggaccaagctcgc
cggctttctgcgtcaaagcctaaacatcgacggaggaatcggccaggctccgggagacga
gagccacggaggctctacattctgtgcaattgcctcgttggctctgtcgaacaggctttg
gactgaagaagtgctcacgcgacgggatatcgatcggcttattcgatgggctattcaaaa
acaggatatcggatttcacggaagggcccataagcctgatgatagttgctatgcattctg
gattggggccacgttga
BLASTn GenBank NR |
|
|
|
|
|
|
ATGTTTCTGGAGTCAAGGCGTCGGC |
66 |
47 |
471 |
Antisense |
GTCGGCTCGGAATCGGACATGCGAT |
117 |
469 |
490 |
Antisense |
GACATGCGATTCGTATTCTGTGCAG |
386 |
369 |
505 |
Antisense |
TGCAGTAGCCATCAGCCATATTCTC |
236 |
579 |
525 |
Antisense |
ATCGACGGAGGAATCGGCCAGGCTC |
487 |
33 |
616 |
Antisense |
CACGGAGGCTCTACATTCTGTGCAA |
277 |
199 |
655 |
Antisense |
CATTCTGTGCAATTGCCTCGTTGGC |
181 |
217 |
668 |
Antisense |
GCCTCGTTGGCTCTGTCGAACAGGC |
179 |
281 |
682 |
Antisense |
AGAAGTGCTCACGCGACGGGATATC |
34 |
75 |
717 |
Antisense |
GATTTCACGGAAGGGCCCATAAGCC |
645 |
427 |
782 |
Antisense |
GCATTCTGGATTGGGGCCACGTTGA |
425 |
307 |
823 |
Antisense | |
|
Affymetrix Proprietary Database |