|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
193715_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.6744
|
|
Exemplar sequence
|
|
Y111B2A.13 NCBI
|
|
Y111B2A.13 /REP_DB=WormBase Gene ID /WP=CE26630 /TR=Q9NEX2 /GB=CAC35842.1 /SUBMIT=HINXTON /CHR=3 /FEA=Sanger Annotation /DEF=transcription initiation factor IIA gamma chain
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_067243(11) |
|
|
|
|
|
NM_067243 NCBI |
Caenorhabditis elegans Y111B2A.13 (Y111B2A.13) mRNA, complete cds. |
11/11 |
None |
Y111B2A.13 ENSEMBL |
cdna:known chromosome:CEL140:III:12624641:12625763:1 gene:Y111B2A.13 |
11/11 |
None | |
SNAP00000006161 |
6/11 |
Cross Hyb Matching Probes |
None |
GENEFINDER00000006268 |
6/11 |
Cross Hyb Matching Probes |
None | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIII:12624644-12625458(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
transcription initiation factor IIA gamma chain
|
|
Y111B2A.13
|
|
176682 Entrez gene
|
|
Q9NEX2 EMBL-EBI
|
|
CE26630 Wormbase
|
Functional Annotations |
|
|
|
|
ATGENOME1:18612_S_AT |
transcription initiation factor IIA gamma chain / TFIIA-gamma (TFIIA-S) |
at |
ATH1-121501:254162_AT |
transcription initiation factor IIA gamma chain / TFIIA-gamma (TFIIA-S) |
at |
CANINE:1587668_AT |
similar to general transcription factor Iia 2 |
cfa |
CANINE_2:CFA.9946.1.S1_AT |
similar to general transcription factor Iia 2 |
cfa |
CANINE_2:CFA.9946.2.S1_S_AT |
similar to general transcription factor Iia 2 |
cfa |
DROSOPHILA_2:1632370_AT |
Transcription-factor-IIA-S |
dm |
DROSGENOME1:143708_AT |
Transcription-factor-IIA-S |
dm |
HG-U95AV2:869_AT |
general transcription factor IIA, 2, 12kDa |
hs |
HC-G110:869_AT |
general transcription factor IIA, 2, 12kDa |
hs |
HG-U133A:202678_AT |
general transcription factor IIA, 2, 12kDa |
hs |
HG-U133_PLUS_2:202678_AT |
general transcription factor IIA, 2, 12kDa |
hs |
HG-FOCUS:202678_AT |
general transcription factor IIA, 2, 12kDa |
hs |
HG-U133A_2:202678_AT |
general transcription factor IIA, 2, 12kDa |
hs |
HUGENEFL:U14193_AT |
general transcription factor IIA, 2, 12kDa |
hs |
U133_X3P:G4758485_3P_S_AT |
general transcription factor IIA, 2, 12kDa |
hs |
HG-U95AV2:37010_AT |
general transcription factor IIA, 2, 12kDa |
hs |
HG-U133_PLUS_2:230376_AT |
General transcription factor IIA, 2, 12kDa |
hs |
HG-U133B:230376_AT |
General transcription factor IIA, 2, 12kDa |
hs |
HG-U133_PLUS_2:243985_AT |
General transcription factor IIA, 2, 12kDa |
hs |
HG-U133B:243985_AT |
General transcription factor IIA, 2, 12kDa |
hs |
HG-U95C:64672_AT |
General transcription factor IIA, 2, 12kDa |
hs |
HU35KSUBC:RC_C21215_AT |
General transcription factor IIA, 2, 12kDa |
hs |
U133_X3P:HS.279528.0.A1_3P_AT |
General transcription factor IIA, 2, 12kDa |
hs |
U133_X3P:HS.44324.0.A1_3P_AT |
General transcription factor IIA, 2, 12kDa |
hs |
RG-U34A:RC_AI012534_AT |
general transcription factor IIa 2 |
rn |
RG-U34C:R47046_AT |
general transcription factor IIa 2 |
rn |
RAE230A:1387775_AT |
general transcription factor IIa 2 |
rn |
RAT230_2:1387775_AT |
general transcription factor IIa 2 |
rn |
YEAST_2:1779551_AT |
TFIIA small subunit; involved in transcriptional activation, acts as antirepressor or as coactivator; homologous to smallest subunit of human and Drosophila TFIIA |
Sc | |
|
|
|
|
|
6367 |
transcription initiation from RNA polymerase II promoter |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5672 |
transcription factor TFIIA complex |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
3702 |
RNA polymerase II transcription factor activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAC35842 |
Hypothetical protein Y111B2A.13 [Caenorhabditis elegans] ref|NP_499644.1| Y111B2A.13 [Caenorhabditis elegans] sp|Q9NEX2|T2AG_CAEEL Probable transcription initiation factor IIA gamma chain (TFIIA P12 subunit) (TFIIA-12) (TFIIAS) (TFIIA-gamma) |
1.0E-60 |
blast |
CAE72838 |
Hypothetical protein CBG20129 [Caenorhabditis briggsae] |
1.0E-48 |
blast |
BAE38203.1 |
unnamed protein product [Mus musculus] |
7.0E-25 | |
|
|
|
|
|
Pfam |
IPR003194 EMBL-EBI |
Transcription initiation factor IIA, gamma subunit |
2.1E-11 |
Pfam |
IPR003194 EMBL-EBI |
Transcription initiation factor IIA, gamma subunit |
2.8E-15 | |
Sequence |
|
>C. ELEGANS:193715_AT
tacaacattgggacaggcccttcagaaaacgctggatgattttgtcggcgatcaaatgat
acctgatagcttatcgaagaaaattatggattctttcgacaaatcaatcaataaaattct
tccgcataaggcgaagaataaggtgaatttccgtgctgacaaacttcgagcctatcggta
ttgtgacaatgtttggacattcatcgtcgaacaaattgatctacgcgatgcagttgaggg
cgggacagtggatcgattgaaaatcgtggcctgtgacgg
BLASTn GenBank NR |
|
|
|
|
|
|
TACAACATTGGGACAGGCCCTTCAG |
614 |
641 |
45 |
Antisense |
GACAGGCCCTTCAGAAAACGCTGGA |
575 |
337 |
56 |
Antisense |
ACGCTGGATGATTTTGTCGGCGATC |
278 |
91 |
73 |
Antisense |
AATAAAATTCTTCCGCATAAGGCGA |
510 |
169 |
154 |
Antisense |
GAATAAGGTGAATTTCCGTGCTGAC |
518 |
315 |
180 |
Antisense |
TCCGTGCTGACAAACTTCGAGCCTA |
450 |
595 |
194 |
Antisense |
TCGAGCCTATCGGTATTGTGACAAT |
16 |
603 |
210 |
Antisense |
AACAAATTGATCTACGCGATGCAGT |
675 |
133 |
254 |
Antisense |
GCGATGCAGTTGAGGGCGGGACAGT |
438 |
289 |
269 |
Antisense |
AGGGCGGGACAGTGGATCGATTGAA |
221 |
57 |
281 |
Antisense |
GATTGAAAATCGTGGCCTGTGACGG |
251 |
427 |
299 |
Antisense | |
|
Affymetrix Proprietary Database |