|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
193688_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.8918
|
|
Exemplar sequence
|
|
F33D4.2C NCBI
|
|
F33D4.2C /REP_DB=WormBase Gene ID /WP=CE28015 /GEN=itr-1 /TR=O61195 /GB=AAB88380.1 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation /DEF=inositol 1,4,5-triphosphate receptor
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001027999(11), NM_001028000(11), NM_001028002(11), NM_001028001(11) |
|
|
|
|
|
NM_001027999 NCBI |
Caenorhabditis elegans Inositol Triphosphate Receptor family member (itr-1) (itr-1) mRNA, complete cds. |
11/11 |
None |
NM_001028000 NCBI |
Caenorhabditis elegans Inositol Triphosphate Receptor family member (itr-1) (itr-1) mRNA, complete cds. |
11/11 |
None |
NM_001028002 NCBI |
Caenorhabditis elegans Inositol Triphosphate Receptor family member (itr-1) (itr-1) mRNA, complete cds. |
11/11 |
None |
NM_001028001 NCBI |
Caenorhabditis elegans Inositol Triphosphate Receptor family member (itr-1) (itr-1) mRNA, complete cds. |
11/11 |
None |
SNAP00000032720 ENSEMBL |
cdna:SNAP chromosome:CEL140:IV:7685641:7696687:1 |
11/11 |
None |
GENEFINDER00000032732 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:IV:7681694:7692973:1 |
11/11 |
None |
F33D4.2a ENSEMBL |
cdna:known chromosome:CEL140:IV:7675157:7696907:1 gene:F33D4.2 |
11/11 |
A |
F33D4.2d ENSEMBL |
cdna:known chromosome:CEL140:IV:7677552:7696687:1 gene:F33D4.2 |
11/11 |
A |
F33D4.2f ENSEMBL |
cdna:known chromosome:CEL140:IV:7681343:7696907:1 gene:F33D4.2 |
11/11 |
A |
F33D4.2e ENSEMBL |
cdna:known chromosome:CEL140:IV:7681343:7696907:1 gene:F33D4.2 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
|
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIV:7681699-7692702(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
F33D4.2
|
Functional Annotations |
|
|
|
|
|
blast |
AAW30668 |
Inositol triphosphate receptor protein 1, isoform a [Caenorhabditis elegans] emb|CAB45861.1| inositol 1,4,5-trisphosphate receptor [Caenorhabditis elegans] ref|NP_001023170.1| Inositol Triphosphate Receptor family member (itr-1) [Caenorhabditis elegans] |
0.0 |
blast |
AAW30669 |
Inositol triphosphate receptor protein 1, isoform d [Caenorhabditis elegans] emb|CAB45862.1| inositol 1,4,5-trisphosphate receptor [Caenorhabditis elegans] ref|NP_001023171.1| Inositol Triphosphate Receptor family member (itr-1) [Caenorhabditis elegans] |
0.0 |
blast |
AAK68366 |
Inositol triphosphate receptor protein 1, isoform f [Caenorhabditis elegans] emb|CAB45860.1| inositol 1,4,5-trisphosphate receptor [Caenorhabditis elegans] ref|NP_001023173.1| Inositol Triphosphate Receptor family member (itr-1) [Caenorhabditis elegans] gb|AAF05302.1| inositol 1,4,5-trisphosphate receptor [Caenorhabditis elegans] |
0.0 |
blast |
AAK68365 |
Inositol triphosphate receptor protein 1, isoform e [Caenorhabditis elegans] emb|CAB45863.1| inositol 1,4,5-trisphosphate receptor [Caenorhabditis elegans] ref|NP_001023172.1| Inositol Triphosphate Receptor family member (itr-1) [Caenorhabditis elegans] |
0.0 | |
|
|
|
|
|
Pfam |
IPR005821 EMBL-EBI |
Ion transport protein |
2.6E-12 |
Pfam |
IPR003608 EMBL-EBI |
MIR domain |
6.7E-6 |
Pfam |
IPR003608 EMBL-EBI |
MIR domain |
5.4E-15 |
Pfam |
IPR000699 EMBL-EBI |
Intracellular calcium-release channel |
9.5E-53 |
Pfam |
IPR000699 EMBL-EBI |
Intracellular calcium-release channel |
3.0E-22 |
Pfam |
IPR005821 EMBL-EBI |
Ion transport protein |
2.6E-12 |
Pfam |
IPR003608 EMBL-EBI |
MIR domain |
6.7E-6 |
Pfam |
IPR003608 EMBL-EBI |
MIR domain |
5.4E-15 |
Pfam |
IPR000699 EMBL-EBI |
Intracellular calcium-release channel |
9.5E-53 |
Pfam |
IPR000699 EMBL-EBI |
Intracellular calcium-release channel |
3.0E-22 |
Pfam |
IPR005821 EMBL-EBI |
Ion transport protein |
2.6E-12 |
Pfam |
IPR003608 EMBL-EBI |
MIR domain |
6.7E-6 |
Pfam |
IPR003608 EMBL-EBI |
MIR domain |
5.4E-15 |
Pfam |
IPR000699 EMBL-EBI |
Intracellular calcium-release channel |
9.5E-53 |
Pfam |
IPR000699 EMBL-EBI |
Intracellular calcium-release channel |
3.0E-22 |
Pfam |
IPR005821 EMBL-EBI |
Ion transport protein |
2.6E-12 |
Pfam |
IPR003608 EMBL-EBI |
MIR domain |
3.5E-12 |
Pfam |
IPR000699 EMBL-EBI |
Intracellular calcium-release channel |
9.5E-53 |
Pfam |
IPR000699 EMBL-EBI |
Intracellular calcium-release channel |
3.0E-22 |
Pfam |
IPR005821 EMBL-EBI |
Ion transport protein |
2.6E-12 |
Pfam |
IPR003608 EMBL-EBI |
MIR domain |
5.4E-15 |
Pfam |
IPR000699 EMBL-EBI |
Intracellular calcium-release channel |
9.5E-53 |
Pfam |
IPR000699 EMBL-EBI |
Intracellular calcium-release channel |
3.0E-22 |
Pfam |
IPR003608 EMBL-EBI |
MIR domain |
7.6E-12 |
Pfam |
IPR000699 EMBL-EBI |
Intracellular calcium-release channel |
9.5E-53 |
Pfam |
IPR000699 EMBL-EBI |
Intracellular calcium-release channel |
3.0E-22 |
NP_001023170.1 |
5 |
2475-2497,2510-2532,2571-2593,2616-2638,2731-2753 |
NP_001023171.1 |
5 |
2419-2441,2454-2476,2515-2537,2560-2582,2675-2697 |
NP_001023173.1 |
5 |
2429-2451,2464-2486,2525-2547,2570-2592,2685-2707 |
NP_001023172.1 |
5 |
2440-2462,2475-2497,2536-2558,2581-2603,2696-2718 |
F33D4.2a |
5 |
2475-2497,2510-2532,2571-2593,2616-2638,2731-2753 |
F33D4.2d |
5 |
2419-2441,2454-2476,2515-2537,2560-2582,2675-2697 |
F33D4.2f |
5 |
2429-2451,2464-2486,2525-2547,2570-2592,2685-2707 |
F33D4.2e |
5 |
2440-2462,2475-2497,2536-2558,2581-2603,2696-2718 |
SNAP00000032720 |
5 |
2143-2165,2178-2200,2239-2261,2284-2306,2399-2421 | |
Sequence |
|
>C. ELEGANS:193688_S_AT
gcaggagcatctgatcttgttactgacattattataatggaaccgagtagagaaatattc
cttaaagcaattcatttagcaagggctcttcttcatgaaggaaatgataaggttcaacac
tctttttacatgcggatgaagcaaaaagacatccatgaaccattcttcaaagctattttg
actagaattcaaacagctcagaacagattgaaaagtgatatgatgagttgcagtgacagt
aaacca
BLASTn GenBank NR |
|
|
|
|
|
|
GCAGGAGCATCTGATCTTGTTACTG |
228 |
311 |
5509 |
Antisense |
GCATCTGATCTTGTTACTGACATTA |
214 |
309 |
5515 |
Antisense |
GAAATATTCCTTAAAGCAATTCATT |
671 |
361 |
5560 |
Antisense |
GCAATTCATTTAGCAAGGGCTCTTC |
621 |
321 |
5575 |
Antisense |
TTAGCAAGGGCTCTTCTTCATGAAG |
211 |
681 |
5584 |
Antisense |
GGTTCAACACTCTTTTTACATGCGG |
397 |
505 |
5619 |
Antisense |
AACACTCTTTTTACATGCGGATGAA |
693 |
135 |
5624 |
Antisense |
AAGACATCCATGAACCATTCTTCAA |
550 |
153 |
5654 |
Antisense |
TGAACCATTCTTCAAAGCTATTTTG |
32 |
573 |
5664 |
Antisense |
GAATTCAAACAGCTCAGAACAGATT |
42 |
323 |
5693 |
Antisense |
GATGAGTTGCAGTGACAGTAAACCA |
296 |
411 |
5730 |
Antisense | |
|
Affymetrix Proprietary Database | |