|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
193652_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.10353
|
|
Exemplar sequence
|
|
Y57G11C.15 NCBI
|
|
Y57G11C.15 /REP_DB=WormBase Gene ID /WP=CE14954 /TR=O18239 /GB=CAB16516.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=protein transport protein SEC61 alpha subunit
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_070392(11) |
|
|
|
|
|
NM_070392 NCBI |
Caenorhabditis elegans Y57G11C.15 (Y57G11C.15) mRNA, complete cds. |
11/11 |
None |
SNAP00000003487 ENSEMBL |
cdna:SNAP chromosome:CEL140:IV:14822801:14824292:-1 |
11/11 |
None |
GENEFINDER00000003611 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:IV:14822801:14825276:-1 |
11/11 |
None |
Y57G11C.15.2 ENSEMBL |
cdna:known chromosome:CEL140:IV:14822494:14825139:-1 gene:Y57G11C.15 |
11/11 |
None |
Y57G11C.15.1 ENSEMBL |
cdna:known chromosome:CEL140:IV:14822494:14824947:-1 gene:Y57G11C.15 |
11/11 |
None |
Y57G11C.15.3 ENSEMBL |
cdna:known chromosome:CEL140:IV:14822504:14824876:-1 gene:Y57G11C.15 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIV:14822806-14824818(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
protein transport protein SEC61 alpha subunit
|
|
Y57G11C.15
|
|
178407 Entrez gene
|
|
O18239 EMBL-EBI
|
|
CE14954 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:264296_AT |
protein transport protein sec61, putative |
at |
ATGENOME1:12389_AT |
protein transport protein sec61, putative |
at |
CANINE:1585833_AT |
similar to Sec61, alpha subunit 2 |
cfa |
CANINE_2:CFA.10701.1.A1_AT |
similar to Sec61, alpha subunit 2 |
cfa |
CANINE_2:CFA.21141.1.S1_S_AT |
similar to Sec61, alpha subunit 2 |
cfa |
CANINE_2:CFAAFFX.8168.1.S1_S_AT |
similar to Sec61, alpha subunit 2 |
cfa |
DROSOPHILA_2:1638663_AT |
|
dm |
DROSGENOME1:154508_AT |
|
dm |
CHICKEN:GGA.16294.2.S1_S_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
gga |
CHICKEN:GGA.5575.1.S1_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
gga |
HG-U133_PLUS_2:219499_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
hs |
HG-U133A:219499_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
hs |
HG-U133A_2:219499_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
hs |
U133_X3P:G8922529_3P_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
hs |
U133_X3P:HS.131840.1.S1_3P_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
hs |
HG-U133_PLUS_2:230215_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
hs |
HG-U133B:230215_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
hs |
HG-U95E:73535_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
hs |
HG-U95E:74690_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
hs |
HU35KSUBB:RC_N62515_S_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
hs |
HU35KSUBC:RC_N49686_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
hs |
HG-U133_PLUS_2:228747_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
hs |
HG-U133B:228747_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
hs |
U133_X3P:HS.301957.2.S1_3P_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
hs |
U133_X3P:HS.301957.0.A2_3P_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
hs |
HG-U133_PLUS_2:222824_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
hs |
HG-U133B:222824_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
hs |
HG-U95C:49172_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
hs |
HG-U95B:57789_AT |
Sec61 alpha 2 subunit (S. cerevisiae) |
hs |
MU11KSUBB:MSA.18113.0_S_AT |
Sec61, alpha subunit 2 (S. cerevisiae) |
mm |
MU11KSUBB:MSA.34154.0_S_AT |
Sec61, alpha subunit 2 (S. cerevisiae) |
mm |
MG-U74AV2:103913_AT |
Sec61, alpha subunit 2 (S. cerevisiae) |
mm |
MG-U74CV2:132815_AT |
Sec61, alpha subunit 2 (S. cerevisiae) |
mm |
MOE430A:1420644_A_AT |
Sec61, alpha subunit 2 (S. cerevisiae) |
mm |
MOUSE430A_2:1420644_A_AT |
Sec61, alpha subunit 2 (S. cerevisiae) |
mm |
MOUSE430_2:1420644_A_AT |
Sec61, alpha subunit 2 (S. cerevisiae) |
mm |
MOE430A:1449944_A_AT |
Sec61, alpha subunit 2 (S. cerevisiae) |
mm |
MOUSE430A_2:1449944_A_AT |
Sec61, alpha subunit 2 (S. cerevisiae) |
mm |
MOUSE430_2:1449944_A_AT |
Sec61, alpha subunit 2 (S. cerevisiae) |
mm |
MU19KSUBB:TC29002_AT |
Sec61, alpha subunit 2 (S. cerevisiae), mRNA (cDNA clone MGC:6359 IMAGE:3494001) |
mm |
RG-U34C:RC_AI228119_AT |
Sec61, alpha subunit 2 (S. cerevisiae) (predicted) |
rn |
RAE230A:1375659_AT |
Sec61, alpha subunit 2 (S. cerevisiae) (predicted) |
rn |
RAT230_2:1375659_AT |
Sec61, alpha subunit 2 (S. cerevisiae) (predicted) |
rn | |
|
|
|
|
|
9306 |
protein secretion |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
16020 |
membrane |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
15450 |
protein translocase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAB16516 |
Hypothetical protein Y57G11C.15 [Caenorhabditis elegans] ref|NP_502793.1| Y57G11C.15 [Caenorhabditis elegans] |
0.0 |
blast |
CAE73902 |
Hypothetical protein CBG21508 [Caenorhabditis briggsae] |
0.0 |
blast |
EAA14690 |
ENSANGP00000016786 [Anopheles gambiae str. PEST] ref|XP_319948.2| ENSANGP00000016786 [Anopheles gambiae str. PEST] |
0.0 | |
|
|
|
|
|
Pfam |
IPR002208 EMBL-EBI |
SecY protein |
4.5E-8 |
Pfam |
IPR002208 EMBL-EBI |
SecY protein |
4.5E-8 |
Pfam |
IPR002208 EMBL-EBI |
SecY protein |
4.5E-8 |
NP_502793.1 |
10 |
33-55,75-97,118-138,143-165,172-193,203-220,241-263,283-305,410-432,437-459 |
Y57G11C.15.2 |
10 |
33-55,75-97,118-138,143-165,172-193,203-220,241-263,283-305,410-432,437-459 |
Y57G11C.15.1 |
10 |
33-55,75-97,118-138,143-165,172-193,203-220,241-263,283-305,410-432,437-459 |
Y57G11C.15.3 |
10 |
33-55,75-97,118-138,143-165,172-193,203-220,241-263,283-305,410-432,437-459 |
SNAP00000003487 |
10 |
2-24,44-66,87-107,112-134,141-162,172-189,210-232,252-274,379-401,406-428 |
GENEFINDER00000003611 |
10 |
105-127,147-169,190-210,215-237,244-265,275-292,313-335,355-377,482-504,509-531 | |
Sequence |
|
>C. ELEGANS:193652_S_AT
caacattccaatcatccttcaatctgctctcgtctccaacctctacgttatctctcagat
gctcgccggaaagttcggaggaaacttcttcatcaaccttctcggtacctggtccgataa
caccggatacagaagctacccaactggaggactctgctactatctttcaccaccagagtc
tcttggacacatcttcgaagacccaatccactgcatcatctacatcgtcttcatgctcgg
atcttgcgcattcttctccaagacctggatcgatgtgtccggatcttctgccaaggatgt
tgccaagcaactcaaggagcaacagatggtcatgcgtggtcatcgtgagaagtccatgat
tcacgagctcaaccgttacatcccaactgccgccgccttcggaggactctgcattggagc
tctt
BLASTn GenBank NR |
|
|
|
|
|
|
CAACATTCCAATCATCCTTCAATCT |
435 |
189 |
873 |
Antisense |
CAACCTCTACGTTATCTCTCAGATG |
486 |
187 |
909 |
Antisense |
CTCTCAGATGCTCGCCGGAAAGTTC |
599 |
229 |
924 |
Antisense |
AGCTACCCAACTGGAGGACTCTGCT |
165 |
77 |
1006 |
Antisense |
CAGAGTCTCTTGGACACATCTTCGA |
386 |
205 |
1046 |
Antisense |
GCATCATCTACATCGTCTTCATGCT |
591 |
309 |
1085 |
Antisense |
TCTTCATGCTCGGATCTTGCGCATT |
312 |
615 |
1100 |
Antisense |
GGATCGATGTGTCCGGATCTTCTGC |
386 |
513 |
1139 |
Antisense |
GGATCTTCTGCCAAGGATGTTGCCA |
637 |
511 |
1153 |
Antisense |
GATTCACGAGCTCAACCGTTACATC |
644 |
429 |
1230 |
Antisense |
CGGAGGACTCTGCATTGGAGCTCTT |
677 |
243 |
1272 |
Antisense | |
|
Affymetrix Proprietary Database | |