|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
193572_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.11973
|
|
Exemplar sequence
|
|
C10G8.5 NCBI
|
|
C10G8.5 /REP_DB=WormBase Gene ID /WP=CE20495 /CHR=5 /FEA=Sanger Annotation /DEF=locus:ncx-2 sodium-calcium exchanger protein 1 (ST.LOUIS) TR:Q94161 protein_id:AAB09172.2
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_072014(11), NM_072013(11), NM_001028473(11), NM_001028472(11) |
|
|
|
|
|
NM_072014 NCBI |
Caenorhabditis elegans Na/Ca eXchangers family member (ncx-2) (ncx-2) mRNA, complete cds. |
11/11 |
None |
NM_072013 NCBI |
Caenorhabditis elegans Na/Ca eXchangers family member (ncx-2) (ncx-2) mRNA, complete cds. |
11/11 |
A |
NM_001028473 NCBI |
Caenorhabditis elegans Na/Ca eXchangers family member (ncx-2) (ncx-2) mRNA, complete cds. |
11/11 |
None |
NM_001028472 NCBI |
Caenorhabditis elegans Na/Ca eXchangers family member (ncx-2) (ncx-2) mRNA, complete cds. |
11/11 |
None |
SNAP00000038000 ENSEMBL |
cdna:SNAP chromosome:CEL140:V:5303505:5310281:1 |
11/11 |
None |
GENEFINDER00000038011 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:V:5303505:5310281:1 |
11/11 |
None |
C10G8.5d ENSEMBL |
cdna:known chromosome:CEL140:V:5303501:5309556:1 gene:C10G8.5 |
11/11 |
None |
C10G8.5b ENSEMBL |
cdna:known chromosome:CEL140:V:5303501:5311058:1 gene:C10G8.5 |
11/11 |
A |
C10G8.5a ENSEMBL |
cdna:known chromosome:CEL140:V:5303505:5310657:1 gene:C10G8.5 |
11/11 |
None |
C10G8.5c.2 ENSEMBL |
cdna:known chromosome:CEL140:V:5306891:5309481:1 gene:C10G8.5 |
11/11 |
None |
C10G8.5c.1 ENSEMBL |
cdna:known chromosome:CEL140:V:5307470:5309481:1 gene:C10G8.5 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrV:5303504-5309466(+) |
97.66 |
98.95 |
| |
Public Domain and Genome References |
|
C10G8.5
|
Functional Annotations |
|
|
|
|
|
blast |
AAM29661 |
Na/ca exchangers protein 2, isoform b [Caenorhabditis elegans] ref|NP_504415.2| Na/Ca eXchangers family member (ncx-2) [Caenorhabditis elegans] |
0.0 |
blast |
CAA04574 |
sodium-calcium exchanger [Caenorhabditis elegans] |
0.0 |
blast |
AAM29660 |
Na/ca exchangers protein 2, isoform a [Caenorhabditis elegans] ref|NP_504414.4| Na/Ca eXchangers family member (ncx-2) [Caenorhabditis elegans] |
0.0 |
blast |
AAN84873 |
Na/ca exchangers protein 2, isoform d [Caenorhabditis elegans] ref|NP_001023644.1| Na/Ca eXchangers family member (ncx-2) [Caenorhabditis elegans] |
0.0 |
blast |
CAE62638 |
Hypothetical protein CBG06769 [Caenorhabditis briggsae] |
0.0 |
blast |
AAN84872 |
Na/ca exchangers protein 2, isoform c [Caenorhabditis elegans] ref|NP_001023643.1| Na/Ca eXchangers family member (ncx-2) [Caenorhabditis elegans] |
0.0 | |
|
|
|
|
|
Pfam |
IPR004837 EMBL-EBI |
Sodium/calcium exchanger membrane region |
1.7E-27 |
Pfam |
IPR004837 EMBL-EBI |
Sodium/calcium exchanger membrane region |
5.1E-23 |
Pfam |
IPR003644 EMBL-EBI |
Na-Ca exchanger/integrin-beta4 |
3.6E-44 |
Pfam |
IPR003644 EMBL-EBI |
Na-Ca exchanger/integrin-beta4 |
5.7E-42 |
Pfam |
IPR004837 EMBL-EBI |
Sodium/calcium exchanger membrane region |
5.0E-28 |
Pfam |
IPR003644 EMBL-EBI |
Na-Ca exchanger/integrin-beta4 |
1.0E-43 |
Pfam |
IPR003644 EMBL-EBI |
Na-Ca exchanger/integrin-beta4 |
5.7E-42 |
Pfam |
IPR004837 EMBL-EBI |
Sodium/calcium exchanger membrane region |
5.0E-28 |
Pfam |
IPR003644 EMBL-EBI |
Na-Ca exchanger/integrin-beta4 |
5.5E-9 |
Pfam |
IPR004837 EMBL-EBI |
Sodium/calcium exchanger membrane region |
5.1E-23 |
Pfam |
IPR004837 EMBL-EBI |
Sodium/calcium exchanger membrane region |
5.0E-28 |
Pfam |
IPR004837 EMBL-EBI |
Sodium/calcium exchanger membrane region |
5.0E-28 |
Pfam |
IPR003644 EMBL-EBI |
Na-Ca exchanger/integrin-beta4 |
7.4E-17 |
Pfam |
IPR003644 EMBL-EBI |
Na-Ca exchanger/integrin-beta4 |
2.8E-4 |
NP_504415.2 |
11 |
7-24,55-77,117-139,149-171,184-206,216-238,749-771,786-808,820-842,857-879,900-922 |
NP_504414.4 |
11 |
7-24,55-77,117-139,149-171,184-206,216-238,799-821,836-858,870-892,907-929,950-972 |
NP_001023644.1 |
10 |
7-24,55-77,117-139,149-171,184-206,216-238,799-821,836-858,870-892,907-929 |
NP_001023643.1 |
3 |
254-276,327-349,364-384 |
C10G8.5d |
10 |
7-24,55-77,117-139,149-171,184-206,216-238,799-821,836-858,870-892,907-929 |
C10G8.5b |
11 |
7-24,55-77,117-139,149-171,184-206,216-238,749-771,786-808,820-842,857-879,900-922 |
C10G8.5a |
11 |
7-24,55-77,117-139,149-171,184-206,216-238,799-821,836-858,870-892,907-929,950-972 |
C10G8.5c.2 |
3 |
254-276,327-349,364-384 |
C10G8.5c.1 |
3 |
254-276,327-349,364-384 |
SNAP00000038000 |
11 |
7-24,55-77,117-139,149-171,184-206,216-238,802-824,839-861,873-895,910-932,953-975 |
GENEFINDER00000038011 |
11 |
7-24,55-77,117-139,149-171,184-206,216-238,775-797,812-834,846-868,883-905,926-948 | |
Sequence |
|
>C. ELEGANS:193572_AT
gttatgcacgttcttactgttccatggaagctcactttcgctaccatcccaccaactgac
tacttcggaggatgggctacattcgttgtcgctatcttcatgattggagtccttaccgct
gttgtaggagatcttgcttctcaattcggatgctgggttggacttaaggatgctgtcacc
gctatctcatttgtcgctttgggaacatctgtgccagatactttcgcatcgaaggtgtcg
gccgttcaggacaagtacgctgataatgccgtcggaaacgtcaccggatccaacgctgtc
aacgttttcttgggtatcggaatcgcctggtcgatggccgcaatctaccattggaatcag
ggaaccaagttcttggttgacccaggaaatcttggattctccgtgctcattttctgcaca
gaagctgttttgtgcatcatcgtcttggtgctca
BLASTn GenBank NR |
|
|
|
|
|
|
GTTATGCACGTTCTTACTGTTCCAT |
264 |
445 |
2347 |
Antisense |
TCCATGGAAGCTCACTTTCGCTACC |
433 |
589 |
2367 |
Antisense |
TCCCACCAACTGACTACTTCGGAGG |
258 |
597 |
2393 |
Antisense |
ATTCGTTGTCGCTATCTTCATGATT |
532 |
9 |
2427 |
Antisense |
CTTGCTTCTCAATTCGGATGCTGGG |
564 |
217 |
2479 |
Antisense |
CTTAAGGATGCTGTCACCGCTATCT |
82 |
221 |
2509 |
Antisense |
GCTATCTCATTTGTCGCTTTGGGAA |
675 |
303 |
2527 |
Antisense |
ATCTGTGCCAGATACTTTCGCATCG |
155 |
35 |
2553 |
Antisense |
TCTTGGGTATCGGAATCGCCTGGTC |
302 |
617 |
2654 |
Antisense |
TTCTCCGTGCTCATTTTCTGCACAG |
78 |
693 |
2743 |
Antisense |
TTGTGCATCATCGTCTTGGTGCTCA |
38 |
707 |
2776 |
Antisense | |
|
Affymetrix Proprietary Database | |