|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
193565_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.8462
|
|
Exemplar sequence
|
|
R10H10.5 NCBI
|
|
R10H10.5 /REP_DB=WormBase Gene ID /WP=CE06296 /GEN=gpa-7 /TR=Q21917 /GB=CAA94612.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=guanine nucleotide-binding protein
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_069520(11) |
|
|
|
|
|
NM_069520 NCBI |
Caenorhabditis elegans G Protein, Alpha subunit family member (gpa-7) (gpa-7) mRNA, complete cds. |
11/11 |
None |
SNAP00000020334 ENSEMBL |
cdna:SNAP chromosome:CEL140:IV:10405987:10408238:1 |
11/11 |
None |
GENEFINDER00000020338 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:IV:10403991:10408238:1 |
11/11 |
None |
R10H10.5 ENSEMBL |
cdna:known chromosome:CEL140:IV:10403991:10408238:1 gene:R10H10.5 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIV:10403996-10408244(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
guanine nucleotide-binding protein
|
|
gpa-7
|
|
R10H10.5
|
|
177931 Entrez gene
|
|
Q21917 EMBL-EBI
|
|
CE06296 Wormbase
|
Functional Annotations |
|
|
|
|
CANINE_2:CFAAFFX.21115.1.S1_AT |
similar to Guanine nucleotide-binding protein G(z), alpha subunit (G(x) alpha chain) (Gz-alpha) |
cfa |
HG-U133_PLUS_2:204993_AT |
guanine nucleotide binding protein (G protein), alpha z polypeptide |
hs |
HG-FOCUS:204993_AT |
guanine nucleotide binding protein (G protein), alpha z polypeptide |
hs |
HG-U133A:204993_AT |
guanine nucleotide binding protein (G protein), alpha z polypeptide |
hs |
HG-U133A_2:204993_AT |
guanine nucleotide binding protein (G protein), alpha z polypeptide |
hs |
HU35KSUBA:D90150_RNA1_S_AT |
guanine nucleotide binding protein (G protein), alpha z polypeptide |
hs |
HU35KSUBC:RC_AA281291_S_AT |
guanine nucleotide binding protein (G protein), alpha z polypeptide |
hs |
HUGENEFL:J03260_S_AT |
guanine nucleotide binding protein (G protein), alpha z polypeptide |
hs |
U133_X3P:G4504050_3P_AT |
guanine nucleotide binding protein (G protein), alpha z polypeptide |
hs |
HG-U95AV2:38279_AT |
guanine nucleotide binding protein (G protein), alpha z polypeptide |
hs |
HG-U133_PLUS_2:229977_AT |
Guanine nucleotide binding protein (G protein), alpha z polypeptide |
hs |
HG-U133B:229977_AT |
Guanine nucleotide binding protein (G protein), alpha z polypeptide |
hs |
MOUSE430A_2:1426517_AT |
guanine nucleotide binding protein, alpha z subunit |
mm |
MOE430A:1426517_AT |
guanine nucleotide binding protein, alpha z subunit |
mm |
MOUSE430_2:1426517_AT |
guanine nucleotide binding protein, alpha z subunit |
mm |
MU11KSUBB:MSA.27268.0_S_AT |
guanine nucleotide binding protein, alpha z subunit |
mm |
MG-U74AV2:100386_AT |
guanine nucleotide binding protein, alpha z subunit |
mm |
MG-U74BV2:106545_AT |
guanine nucleotide binding protein, alpha z subunit |
mm |
MG-U74BV2:163413_AT |
guanine nucleotide binding protein, alpha z subunit |
mm |
RG-U34A:J03773_S_AT |
guanine nucleotide binding protein, alpha z subunit |
rn |
RG-U34A:U77483MRNA_S_AT |
guanine nucleotide binding protein, alpha z subunit |
rn |
RAE230A:1387095_AT |
guanine nucleotide binding protein, alpha z subunit |
rn |
RAT230_2:1387095_AT |
guanine nucleotide binding protein, alpha z subunit |
rn |
RAE230A:1368185_AT |
guanine nucleotide binding protein, alpha z subunit |
rn |
RAT230_2:1368185_AT |
guanine nucleotide binding protein, alpha z subunit |
rn | |
|
|
|
|
|
7186 |
G-protein coupled receptor protein signaling pathway |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
4871 |
signal transducer activity |
inferred from electronic annotation |
QuickGO AmiGO |
5525 |
GTP binding |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAA94612 |
Hypothetical protein R10H10.5 [Caenorhabditis elegans] ref|NP_501921.1| G Protein, Alpha subunit family member (gpa-7) [Caenorhabditis elegans] gb|AAG32083.1| heterotrimeric G protein alpha subunit [Caenorhabditis elegans] sp|Q21917|GPA7_CAEEL Guanine nucleotide-binding protein alpha-7 subunit |
0.0 |
blast |
AAW02906 |
gpa-7 [Caenorhabditis briggsae] sp|Q61MQ8|GPA7_CAEBR Guanine nucleotide-binding protein alpha-7 subunit emb|CAE63826.1| Hypothetical protein CBG08377 [Caenorhabditis briggsae] |
0.0 |
blast |
CAA94612 |
Hypothetical protein R10H10.5 [Caenorhabditis elegans] ref|NP_501921.1| G Protein, Alpha subunit family member (gpa-7) [Caenorhabditis elegans] gb|AAG32083.1| heterotrimeric G protein alpha subunit [Caenorhabditis elegans] sp|Q21917|GPA7_CAEEL Guanine nucleotide-binding protein alpha-7 subunit |
1.0E-176 |
blast |
AAW02906 |
gpa-7 [Caenorhabditis briggsae] sp|Q61MQ8|GPA7_CAEBR Guanine nucleotide-binding protein alpha-7 subunit emb|CAE63826.1| Hypothetical protein CBG08377 [Caenorhabditis briggsae] |
1.0E-174 |
blast |
EAL26334 |
GA15300-PA [Drosophila pseudoobscura] |
1.0E-119 | |
|
|
|
|
|
Pfam |
IPR001019 EMBL-EBI |
Guanine nucleotide binding protein (G-protein), alpha subunit |
1.0E-126 |
Pfam |
IPR001019 EMBL-EBI |
Guanine nucleotide binding protein (G-protein), alpha subunit |
1.0E-126 | |
Sequence |
|
>C. ELEGANS:193565_AT
tgatgactctgcaaaatacttccttgacaacttgccacgtctctcatctccaaactacgt
gccaagtgagcaggatcttttgaggacacgaataaaaacaacaggaataacagaagtttt
gtttgaactgaaagggctcacatttcgagtgatagatgttggagggcaacgatcagaaag
aaagaaatggattcattgtttcgataatgttaatgcaatcatttttatatcatctttatc
agagtatgatcaaactttgagagaagataattgcacgaaccgaatgcaagaatcattgaa
actgtttgactcaatctgtaatagtccatggtttgcggatattcactttattttattttt
aaataagaaggacttgttcgctgaaaaaattgtccgatcaccattgaccgtttgcttccc
agaatacaagggacaacagaatcaaacagaatgtattaattacattcaatggaagtttga
acaacttaataggtcctcccaacgtgaaatctattgtcatcacacatgtgccacagacac
aaataacgttcaattcgtgttggacgcctgtctcgatatgattat
BLASTn GenBank NR |
|
|
|
|
|
|
TGATGACTCTGCAAAATACTTCCTT |
21 |
567 |
453 |
Antisense |
AAATACTTCCTTGACAACTTGCCAC |
540 |
115 |
466 |
Antisense |
TCATCTCCAAACTACGTGCCAAGTG |
331 |
621 |
496 |
Antisense |
GAGCAGGATCTTTTGAGGACACGAA |
577 |
389 |
520 |
Antisense |
AATTGTCCGATCACCATTGACCGTT |
631 |
173 |
840 |
Antisense |
ACCGTTTGCTTCCCAGAATACAAGG |
624 |
85 |
859 |
Antisense |
TGAACAACTTAATAGGTCCTCCCAA |
534 |
571 |
930 |
Antisense |
TAGGTCCTCCCAACGTGAAATCTAT |
499 |
649 |
942 |
Antisense |
TTGTCATCACACATGTGCCACAGAC |
178 |
705 |
966 |
Antisense |
ACGTTCAATTCGTGTTGGACGCCTG |
216 |
95 |
998 |
Antisense |
TGGACGCCTGTCTCGATATGATTAT |
99 |
549 |
1013 |
Antisense | |
|
Affymetrix Proprietary Database |