|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
193564_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.16566
|
|
Exemplar sequence
|
|
F20B6.2 NCBI
|
|
F20B6.2 /REP_DB=WormBase Gene ID /WP=CE04424 /GEN=vha-12 /TR=SW:Q19626 /GB=AAA82311.1 /SUBMIT=ST.LOUIS /CHR=X /FEA=Sanger Annotation /DEF=vacuolar ATP synthase (strong)
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_076310(11) |
|
|
|
|
|
NM_076310 NCBI |
Caenorhabditis elegans Vacuolar H ATPase family member (vha-12) (vha-12) mRNA, complete cds. |
11/11 |
None |
SNAP00000010533 ENSEMBL |
cdna:SNAP chromosome:CEL140:X:4191070:4192692:1 |
11/11 |
None |
GENEFINDER00000010547 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:X:4191070:4192692:1 |
11/11 |
None |
F20B6.2.3 ENSEMBL |
cdna:known chromosome:CEL140:X:4191066:4193107:1 gene:F20B6.2 |
11/11 |
None |
F20B6.2.2 ENSEMBL |
cdna:known chromosome:CEL140:X:4191066:4193118:1 gene:F20B6.2 |
11/11 |
None |
F20B6.2.1 ENSEMBL |
cdna:known chromosome:CEL140:X:4191068:4193118:1 gene:F20B6.2 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrX:4191070-4192693(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
vacuolar ATP synthase (strong)
|
|
vha-12
|
|
F20B6.2
|
|
180692 Entrez gene
|
|
Q19626 EMBL-EBI
|
|
CE04424 Wormbase
|
Functional Annotations |
|
|
|
|
ATGENOME1:12804_AT |
vacuolar ATP synthase subunit B, putative / V-ATPase B subunit, putative / vacuolar proton pump B subunit, putative / V-ATPase 57 kDa subunit, putative |
at |
ATH1-121501:252998_AT |
vacuolar ATP synthase subunit B, putative / V-ATPase B subunit, putative / vacuolar proton pump B subunit, putative / V-ATPase 57 kDa subunit, putative |
at |
CANINE:1591427_AT |
similar to ATPase, H+ transporting, lysosomal 56/58kD, V1 subunit B, isoform 1 |
cfa |
CANINE_2:CFA.14021.1.A1_AT |
similar to ATPase, H+ transporting, lysosomal 56/58kD, V1 subunit B, isoform 1 |
cfa |
CANINE_2:CFAAFFX.6127.1.S1_AT |
similar to ATPase, H+ transporting, lysosomal 56/58kD, V1 subunit B, isoform 1 |
cfa |
HG-U133_PLUS_2:205473_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 1 (Renal tubular acidosis with deafness) |
hs |
HG-U133A:205473_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 1 (Renal tubular acidosis with deafness) |
hs |
HG-FOCUS:205473_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 1 (Renal tubular acidosis with deafness) |
hs |
HG-U133A_2:205473_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 1 (Renal tubular acidosis with deafness) |
hs |
HU35KSUBC:RC_AA477818_F_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 1 (Renal tubular acidosis with deafness) |
hs |
HUGENEFL:M25809_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 1 (Renal tubular acidosis with deafness) |
hs |
U133_X3P:G4502308_3P_X_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 1 (Renal tubular acidosis with deafness) |
hs |
U133_X3P:G4502308_3P_S_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 1 (Renal tubular acidosis with deafness) |
hs |
U133_X3P:G4502308_3P_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 1 (Renal tubular acidosis with deafness) |
hs |
U133_X3P:HS2.385681.1.S1_3P_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 1 (Renal tubular acidosis with deafness) |
hs |
HG-U133_PLUS_2:1554847_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 1 (Renal tubular acidosis with deafness) |
hs |
HG-U95AV2:32959_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 1 (Renal tubular acidosis with deafness) |
hs |
HG-U95B:46588_F_AT |
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 1 (Renal tubular acidosis with deafness) |
hs |
MG-U74BV2:114615_AT |
ATPase, H+ transporting, V1 subunit B, isoform 1 |
mm |
MOE430A:1419373_AT |
ATPase, H+ transporting, V1 subunit B, isoform 1 |
mm |
MOUSE430A_2:1419373_AT |
ATPase, H+ transporting, V1 subunit B, isoform 1 |
mm |
MOUSE430_2:1419373_AT |
ATPase, H+ transporting, V1 subunit B, isoform 1 |
mm |
MG-U74BV2:111602_AT |
ATPase, H+ transporting, V1 subunit B, isoform 1 (Atp6v1b1), mRNA |
mm |
RAE230B:1385400_AT |
ATPase, H+ transporting, V1 subunit B, isoform 1 (predicted) |
rn |
RAT230_2:1385400_AT |
ATPase, H+ transporting, V1 subunit B, isoform 1 (predicted) |
rn | |
|
|
|
|
|
6754 |
ATP biosynthesis |
inferred from electronic annotation |
QuickGO AmiGO |
15986 |
ATP synthesis coupled proton transport |
inferred from electronic annotation |
QuickGO AmiGO |
15988 |
energy coupled proton transport, against electrochemical gradient |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5737 |
cytoplasm |
inferred from electronic annotation |
QuickGO AmiGO |
16469 |
proton-transporting two-sector ATPase complex |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5524 |
ATP binding |
inferred from electronic annotation |
QuickGO AmiGO |
8553 |
hydrogen-exporting ATPase activity, phosphorylative mechanism |
inferred from electronic annotation |
QuickGO AmiGO |
46933 |
hydrogen-transporting ATP synthase activity, rotational mechanism |
inferred from electronic annotation |
QuickGO AmiGO |
46961 |
hydrogen-transporting ATPase activity, rotational mechanism |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
AAA82311 |
Vacuolar h atpase protein 12 [Caenorhabditis elegans] ref|NP_508711.1| Vacuolar H ATPase family member (vha-12) [Caenorhabditis elegans] sp|Q19626|VATB_CAEEL Probable vacuolar ATP synthase subunit B (V-ATPase B subunit) (Vacuolar proton pump B subunit) |
0.0 |
blast |
CAE68535 |
Hypothetical protein CBG14362 [Caenorhabditis briggsae] |
0.0 |
blast |
CAE65728 |
Hypothetical protein CBG10811 [Caenorhabditis briggsae] |
0.0 | |
|
|
|
|
|
Pfam |
IPR004100 EMBL-EBI |
H+-transporting two-sector ATPase, alpha/beta subunit, N-terminal |
5.8E-18 |
Pfam |
IPR000194 EMBL-EBI |
H+-transporting two-sector ATPase, alpha/beta subunit, central region |
9.5E-81 |
Pfam |
IPR000793 EMBL-EBI |
H+-transporting two-sector ATPase, alpha/beta subunit, C-terminal |
3.0E-28 | |
Sequence |
|
>C. ELEGANS:193564_S_AT
gtacactgatttggccaccatctacgagcgtgccggtcgtgtcgaaggaagagacggatc
aatcacacaaattccaattcttactatgccaaacgacgatattactcaccctatcccaga
tttgactggttacattaccgagggacagatctacgtcgatcgtcagcttcacaatcgtct
tatctacccaccaatcaacgtactcccatccctttcccgacttatgaagtctgctattgg
agaaggaatgacaagagaagatcactccgatgtgtctaaccagctctacgcttgttacgc
tatcggaaaggacgtgcaagctatgaaggccgtcgtcggagaagaagccttgtcatctga
tgatttgctctacctcgagttcttgacaaagttcgagaagaacttcatcacccaaggtca
ctacgaaaacagaagtgtcttcgaatccctcgacatcggatggcaacttctccgtatctt
cccacgtgaaatgctcaagcgtattccagagtctacccttgagaa
BLASTn GenBank NR |
|
|
|
|
|
|
GTACACTGATTTGGCCACCATCTAC |
393 |
461 |
933 |
Antisense |
GCCAAACGACGATATTACTCACCCT |
214 |
275 |
1020 |
Antisense |
AGATCTACGTCGATCGTCAGCTTCA |
520 |
65 |
1079 |
Antisense |
GTCAGCTTCACAATCGTCTTATCTA |
174 |
467 |
1094 |
Antisense |
TCTTATCTACCCACCAATCAACGTA |
19 |
617 |
1110 |
Antisense |
GATCACTCCGATGTGTCTAACCAGC |
265 |
421 |
1192 |
Antisense |
CTAACCAGCTCTACGCTTGTTACGC |
58 |
227 |
1208 |
Antisense |
TCATCTGATGATTTGCTCTACCTCG |
639 |
621 |
1285 |
Antisense |
GAACTTCATCACCCAAGGTCACTAC |
548 |
349 |
1332 |
Antisense |
CGGATGGCAACTTCTCCGTATCTTC |
155 |
243 |
1389 |
Antisense |
GTATTCCAGAGTCTACCCTTGAGAA |
661 |
451 |
1433 |
Antisense | |
|
Affymetrix Proprietary Database | |