|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
193562_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.10094
|
|
Exemplar sequence
|
|
F23B2.5 NCBI
|
|
F23B2.5 /REP_DB=WormBase Gene ID /WP=CE09585 /GEN=flp-1 /TR=SW:P41855 /GB=CAB05179.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=FMFRamide neuropeptide precursor
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_182277(11), NM_069191(11), NM_182278(11) |
|
|
|
|
|
NM_182277 NCBI |
Caenorhabditis elegans FMRF-Like Peptide family member (flp-1) (flp-1) mRNA, complete cds. |
11/11 |
A |
NM_069191 NCBI |
Caenorhabditis elegans FMRF-Like Peptide family member (flp-1) (flp-1) mRNA, complete cds. |
11/11 |
A |
NM_182278 NCBI |
Caenorhabditis elegans FMRF-Like Peptide family member (flp-1) (flp-1) mRNA, complete cds. |
11/11 |
None |
SNAP00000024643 ENSEMBL |
cdna:SNAP chromosome:CEL140:IV:9144694:9145958:1 |
11/11 |
None |
GENEFINDER00000024651 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:IV:9144694:9146013:1 |
10/11 |
None |
F23B2.5a ENSEMBL |
cdna:known chromosome:CEL140:IV:9144686:9146096:1 gene:F23B2.5 |
11/11 |
A |
F23B2.5b ENSEMBL |
cdna:known chromosome:CEL140:IV:9144686:9146116:1 gene:F23B2.5 |
11/11 |
A |
F23B2.5c ENSEMBL |
cdna:known chromosome:CEL140:IV:9144694:9145958:1 gene:F23B2.5 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIV:9144699-9145964(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
F23B2.5
|
Functional Annotations |
|
|
|
|
|
blast |
CAB05179 |
Hypothetical protein F23B2.5a [Caenorhabditis elegans] ref|NP_501592.1| FMRF-Like Peptide family member (flp-1) [Caenorhabditis elegans] gb|AAB22368.1| FMRFamide-like peptide [Caenorhabditis elegans] gb|AAC46464.1| FLP-1 [Caenorhabditis elegans] sp|P41855|FARP_CAEEL FMRFamide-like neuropeptides precursor [Contains: PNFMRY-amide; AGSDPNFLRF-amide; SQPNFLRF-amide; ASGDPNFLRF-amide; SDPNFLRF-amide (PF1); AAADPNFLRF-amide; SADPNFLRF-amide (PF2); PNFLRF-amide] |
7.0E-92 |
blast |
AAA74036 |
CV-FLP-1B |
2.0E-88 |
blast |
CAE74119 |
Hypothetical protein CBG21782 [Caenorhabditis briggsae] |
1.0E-87 |
blast |
CAD56243 |
Hypothetical protein F23B2.5b [Caenorhabditis elegans] ref|NP_872077.1| FMRF-Like Peptide family member (flp-1) [Caenorhabditis elegans] |
5.0E-86 | |
|
|
|
|
|
Pfam |
IPR002544 EMBL-EBI |
FMRFamide-related peptide |
0.0063 |
Pfam |
IPR002544 EMBL-EBI |
FMRFamide-related peptide |
0.0059 |
Pfam |
IPR002544 EMBL-EBI |
FMRFamide-related peptide |
0.26 |
Pfam |
IPR002544 EMBL-EBI |
FMRFamide-related peptide |
0.0053 |
Pfam |
IPR002544 EMBL-EBI |
FMRFamide-related peptide |
0.082 |
Pfam |
IPR002544 EMBL-EBI |
FMRFamide-related peptide |
0.0096 |
Pfam |
IPR002544 EMBL-EBI |
FMRFamide-related peptide |
0.0022 |
Pfam |
IPR002544 EMBL-EBI |
FMRFamide-related peptide |
0.0041 |
Pfam |
IPR002544 EMBL-EBI |
FMRFamide-related peptide |
0.0022 |
Pfam |
IPR002544 EMBL-EBI |
FMRFamide-related peptide |
0.26 |
Pfam |
IPR002544 EMBL-EBI |
FMRFamide-related peptide |
0.0053 |
Pfam |
IPR002544 EMBL-EBI |
FMRFamide-related peptide |
0.082 |
Pfam |
IPR002544 EMBL-EBI |
FMRFamide-related peptide |
0.0096 |
Pfam |
IPR002544 EMBL-EBI |
FMRFamide-related peptide |
0.0022 |
Pfam |
IPR002544 EMBL-EBI |
FMRFamide-related peptide |
0.0041 |
Pfam |
IPR002544 EMBL-EBI |
FMRFamide-related peptide |
0.082 |
Pfam |
IPR002544 EMBL-EBI |
FMRFamide-related peptide |
0.0096 |
Pfam |
IPR002544 EMBL-EBI |
FMRFamide-related peptide |
0.0022 |
Pfam |
IPR002544 EMBL-EBI |
FMRFamide-related peptide |
0.0041 | |
Sequence |
|
>C. ELEGANS:193562_S_AT
gtgaccctaacttcttgagatttggaaaagccgctgctgatccaaatttcttgagattcg
gaaaacgatctgcagatcctaacttcttgagattcggacgctcattcgacaacttcgatc
gtgaatc
BLASTn GenBank NR |
|
|
|
|
|
|
GTGACCCTAACTTCTTGAGATTTGG |
587 |
481 |
380 |
Antisense |
TGAGATTTGGAAAAGCCGCTGCTGA |
521 |
551 |
395 |
Antisense |
AAAAGCCGCTGCTGATCCAAATTTC |
244 |
131 |
405 |
Antisense |
CCGCTGCTGATCCAAATTTCTTGAG |
369 |
263 |
410 |
Antisense |
GCTGATCCAAATTTCTTGAGATTCG |
600 |
295 |
415 |
Antisense |
TTCGGAAAACGATCTGCAGATCCTA |
350 |
695 |
436 |
Antisense |
CGATCTGCAGATCCTAACTTCTTGA |
140 |
249 |
445 |
Antisense |
GCAGATCCTAACTTCTTGAGATTCG |
522 |
311 |
451 |
Antisense |
CTAACTTCTTGAGATTCGGACGCTC |
71 |
227 |
458 |
Antisense |
AGATTCGGACGCTCATTCGACAACT |
478 |
63 |
469 |
Antisense |
CATTCGACAACTTCGATCGTGAATC |
578 |
215 |
482 |
Antisense | |
|
Affymetrix Proprietary Database |