|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
193533_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.14656
|
|
Exemplar sequence
|
|
F57A10.3 NCBI
|
|
F57A10.3 /REP_DB=WormBase Gene ID /WP=CE16149 /TR=O17895 /GB=CAB09418.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=multidrug resistance protein (p-glycoprotein)
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_074526(11) |
|
|
|
|
|
NM_074526 NCBI |
Caenorhabditis elegans HAlF transporter (PGP related) family member (haf-3) (haf-3) mRNA, complete cds. |
11/11 |
None |
SNAP00000005218 ENSEMBL |
cdna:SNAP chromosome:CEL140:V:15763240:15769361:-1 |
11/11 |
None |
GENEFINDER00000005230 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:V:15763240:15768748:-1 |
11/11 |
None |
F57A10.3 ENSEMBL |
cdna:known chromosome:CEL140:V:15763031:15769000:-1 gene:F57A10.3 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrV:15763239-15769000(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
multidrug resistance protein (p-glycoprotein)
|
|
haf-3
|
|
F57A10.3
|
|
180056 Entrez gene
|
|
O17895 EMBL-EBI
|
|
CE16149 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:249487_AT |
ABC transporter (TAP2) |
at |
DROSOPHILA_2:1640813_AT |
|
dm |
DROSGENOME1:153917_AT |
|
dm |
CHICKEN:GGAAFFX.20845.1.S1_AT |
similar to ATP-binding cassette, sub-family B, member 10 |
gga |
HG-U133_PLUS_2:223320_S_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
hs |
HG-U133B:223320_S_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
hs |
HU35KSUBB:RC_R83876_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
hs |
HUGENEFL:U18237_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
hs |
U133_X3P:G12751097_3P_X_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
hs |
U133_X3P:G12751097_3P_A_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
hs |
HG-U95AV2:35458_R_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
hs |
HG-U95C:59294_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
hs |
HG-U95C:58640_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
hs |
HU35KSUBA:AA434506_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
hs |
HU35KSUBC:RC_AA434409_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
hs |
HU35KSUBB:RC_W84624_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
hs |
MOUSE430_2:1454265_A_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
mm |
MOE430A:1454265_A_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
mm |
MOUSE430A_2:1454265_A_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
mm |
MU11KSUBA:AA272457_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
mm |
MG-U74AV2:104394_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
mm |
MG-U74BV2:164823_R_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
mm |
MOE430A:1416403_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
mm |
MOUSE430A_2:1416403_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
mm |
MOUSE430_2:1416403_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
mm |
MOE430A:1416402_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
mm |
MOUSE430A_2:1416402_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
mm |
MOUSE430_2:1416402_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 |
mm |
MU19KSUBB:TC33528_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 (Abcb10), nuclear gene encoding mitochondrial protein, mRNA |
mm |
RAE230B:1382963_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 (predicted) |
rn |
RAT230_2:1382963_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 (predicted) |
rn |
RG-U34B:RC_AA944536_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 (predicted) |
rn |
RAE230B:1390781_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 (predicted) |
rn |
RAT230_2:1390781_AT |
ATP-binding cassette, sub-family B (MDR/TAP), member 10 (predicted) |
rn |
YEAST_2:1775258_AT |
Half-type ATP-binding cassette (ABC) transporter of the inner mitochondrial membrane, mediates export of peptides generated upon proteolysis of mitochondrial proteins, plays a role in the regulation of cellular resistance to oxidative stress |
Sc | |
|
|
|
|
|
6810 |
transport |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
16020 |
membrane |
inferred from electronic annotation |
QuickGO AmiGO |
16021 |
integral to membrane |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
166 |
nucleotide binding |
inferred from electronic annotation |
QuickGO AmiGO |
5524 |
ATP binding |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAB09418 |
Hypothetical protein F57A10.3 [Caenorhabditis elegans] ref|NP_506927.1| HAlF transporter (PGP related) family member (haf-3) [Caenorhabditis elegans] |
0.0 |
blast |
CAE56320 |
Hypothetical protein CBG23985 [Caenorhabditis briggsae] |
0.0 |
blast |
CAB02812 |
Hypothetical protein C30H6.6 [Caenorhabditis elegans] ref|NP_503098.1| HAlF transporter (PGP related) family member (haf-1) [Caenorhabditis elegans] |
1.0E-159 | |
|
|
|
|
|
Pfam |
IPR001140 EMBL-EBI |
ABC transporter, transmembrane region |
3.7E-42 |
Pfam |
IPR003439 EMBL-EBI |
ABC transporter |
4.0E-72 |
Pfam |
IPR001140 EMBL-EBI |
ABC transporter, transmembrane region |
2.3E-41 |
Pfam |
IPR003439 EMBL-EBI |
ABC transporter |
4.0E-72 |
Pfam |
IPR001140 EMBL-EBI |
ABC transporter, transmembrane region |
4.5E-34 |
Pfam |
IPR003439 EMBL-EBI |
ABC transporter |
4.0E-72 |
NP_506927.1 |
5 |
154-176,208-227,303-325,391-413,426-448 |
F57A10.3 |
5 |
154-176,208-227,303-325,391-413,426-448 |
SNAP00000005218 |
5 |
39-61,98-117,193-215,281-303,316-338 |
GENEFINDER00000005230 |
5 |
87-109,141-160,254-276,342-364,377-399 | |
Sequence |
|
>C. ELEGANS:193533_S_AT
cctcgcttttgcttagactctacgatccaacgagcggtcgaattttggtcgacggaaccg
atttgaaggacattgatccatcatattggcgtcgtcatattggaacagttggacaagaac
cggttttattctcgacaactatcaaagagaatattatttatggaagtcttgaacctgaaa
acgttaccgacgctgaaatcgtctcagcagccgatcaatccaacgccgatgagtttatca
gccgattcccaattaaatatgacacaaaggtcggtgagcacggatcaacactaagtggag
gacaaaagcagagaattgccatcgcccgtgctcttgtcaataagccgaatattctaatta
tggatgaagccacatcggcactcgacgcctcgtcagaatatctcgttcgaattgctctca
acaaattgctcgcgaatagtaaacagactgttatgattattgctcacagactgtccacaa
tcaagcatgccgatcaaatcgttgtagtcgatagaggaagtgttgcagaatctggaagct
atgacgagcttatcgctatccccgacggaattttca
BLASTn GenBank NR |
|
|
|
|
|
|
CCTCGCTTTTGCTTAGACTCTACGA |
346 |
267 |
1586 |
Antisense |
GATCCATCATATTGGCGTCGTCATA |
305 |
415 |
1660 |
Antisense |
CCGATCAATCCAACGCCGATGAGTT |
179 |
265 |
1796 |
Antisense |
TGAGTTTATCAGCCGATTCCCAATT |
135 |
569 |
1815 |
Antisense |
AGGTCGGTGAGCACGGATCAACACT |
99 |
57 |
1853 |
Antisense |
GACGCCTCGTCAGAATATCTCGTTC |
117 |
381 |
1969 |
Antisense |
ATCTCGTTCGAATTGCTCTCAACAA |
330 |
33 |
1985 |
Antisense |
TGATTATTGCTCACAGACTGTCCAC |
181 |
565 |
2039 |
Antisense |
CTGTCCACAATCAAGCATGCCGATC |
463 |
239 |
2056 |
Antisense |
GCTATGACGAGCTTATCGCTATCCC |
242 |
303 |
2123 |
Antisense |
ATCGCTATCCCCGACGGAATTTTCA |
362 |
37 |
2137 |
Antisense | |
|
Affymetrix Proprietary Database | |