|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
193424_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.1923
|
|
Exemplar sequence
|
|
C31H5.3 NCBI
|
|
C31H5.3 /REP_DB=WormBase Gene ID /WP=CE17483 /GEN=acr-19 /TR=O62083 /GB=CAB07843.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation /DEF=nicotinic acetylcholine receptor
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_060028(11) |
|
|
|
|
|
NM_060028 NCBI |
Caenorhabditis elegans AcetylCholine Receptor family member (acr-19) (acr-19) mRNA, complete cds. |
11/11 |
None |
SNAP00000044187 ENSEMBL |
cdna:SNAP chromosome:CEL140:I:9039556:9041748:-1 |
11/11 |
None |
GENEFINDER00000044196 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:I:9039556:9047491:-1 |
11/11 |
None |
C31H5.3 ENSEMBL |
cdna:known chromosome:CEL140:I:9039372:9044819:-1 gene:C31H5.3 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:9039486-9042067(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
nicotinic acetylcholine receptor
|
|
acr-19
|
|
C31H5.3
|
|
191605 Entrez gene
|
|
O62083 EMBL-EBI
|
|
CE30494 Wormbase
|
Functional Annotations |
|
|
|
|
CANINE:1590844_AT |
similar to Neuronal acetylcholine receptor protein, alpha-7 subunit precursor |
cfa |
CANINE_2:CFA.4753.1.A1_AT |
similar to Neuronal acetylcholine receptor protein, alpha-7 subunit precursor |
cfa |
CANINE_2:CFAAFFX.16022.1.S1_S_AT |
similar to Neuronal acetylcholine receptor protein, alpha-7 subunit precursor |
cfa |
DROSOPHILA_2:1641662_AT |
nicotinic Acetylcholine Receptor 34E |
dm |
DROSGENOME1:144282_AT |
nicotinic Acetylcholine Receptor 34E |
dm |
DROSGENOME1:144281_AT |
nicotinic Acetylcholine Receptor 34E |
dm |
CHICKEN:GGA.4000.1.S1_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
gga |
HG-U133_PLUS_2:210123_S_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
hs |
HG-U133A:210123_S_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
hs |
HG-FOCUS:210123_S_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
hs |
HG-U133A_2:210123_S_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
hs |
HU35KSUBD:RC_N54079_S_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
hs |
HUGENEFL:X70297_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
hs |
U133_X3P:G1458119_3P_A_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
hs |
HG-U95AV2:39566_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
hs |
U133_X3P:HS.207457.0.A1_3P_AT |
Cholinergic receptor, nicotinic, alpha polypeptide 7 |
hs |
HG-U133_PLUS_2:236385_AT |
Cholinergic receptor, nicotinic, alpha polypeptide 7 |
hs |
HG-U133B:236385_AT |
Cholinergic receptor, nicotinic, alpha polypeptide 7 |
hs |
HG-U95D:69847_AT |
Cholinergic receptor, nicotinic, alpha polypeptide 7 |
hs |
HG-U95D:80966_AT |
Cholinergic receptor, nicotinic, alpha polypeptide 7 |
hs |
HG-U95B:47235_AT |
Cholinergic receptor, nicotinic, alpha polypeptide 7 |
hs |
MG-U74AV2:101131_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
mm |
MOE430A:1450299_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
mm |
MOUSE430A_2:1450299_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
mm |
MOUSE430_2:1450299_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
mm |
MU11KSUBA:L37663_S_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
mm |
RN-U34:L31619_G_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
rn |
RG-U34A:L31619_G_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
rn |
RN-U34:L31619_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
rn |
RG-U34A:L31619_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
rn |
RN-U34:S53987_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
rn |
RG-U34A:S53987_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
rn |
RAE230A:1387419_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
rn |
RAT230_2:1387419_AT |
cholinergic receptor, nicotinic, alpha polypeptide 7 |
rn | |
|
|
|
|
|
6810 |
transport |
inferred from electronic annotation |
QuickGO AmiGO |
6811 |
ion transport |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
16020 |
membrane |
inferred from electronic annotation |
QuickGO AmiGO |
16021 |
integral to membrane |
inferred from electronic annotation |
QuickGO AmiGO |
45211 |
postsynaptic membrane |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
4889 |
nicotinic acetylcholine-activated cation-selective channel activity |
inferred from electronic annotation |
QuickGO AmiGO |
5216 |
ion channel activity |
inferred from electronic annotation |
QuickGO AmiGO |
5230 |
extracellular ligand-gated ion channel activity |
inferred from electronic annotation |
QuickGO AmiGO |
30594 |
neurotransmitter receptor activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAB07843 |
Hypothetical protein C31H5.3 [Caenorhabditis elegans] ref|NP_492429.2| AcetylCholine Receptor family member (acr-19) [Caenorhabditis elegans] gb|AAR98636.1| acetylcholine receptor (63.2 kD) (acr-19) [Caenorhabditis elegans] |
0.0 |
blast |
CAE67024 |
Hypothetical protein CBG12425 [Caenorhabditis briggsae] |
0.0 |
blast |
AAS64703 |
CG32975-PB, isoform B [Drosophila melanogaster] ref|NP_995708.1| CG32975-PB, isoform B [Drosophila melanogaster] |
1.0E-108 | |
|
|
|
|
|
Pfam |
IPR006029 EMBL-EBI |
Neurotransmitter-gated ion-channel transmembrane region |
6.4E-45 |
Pfam |
IPR006202 EMBL-EBI |
Neurotransmitter-gated ion-channel ligand binding domain |
1.5E-67 |
Pfam |
IPR006029 EMBL-EBI |
Neurotransmitter-gated ion-channel transmembrane region |
6.4E-45 |
Pfam |
IPR006202 EMBL-EBI |
Neurotransmitter-gated ion-channel ligand binding domain |
7.4E-97 |
Pfam |
IPR006029 EMBL-EBI |
Neurotransmitter-gated ion-channel transmembrane region |
6.4E-45 |
Pfam |
IPR006202 EMBL-EBI |
Neurotransmitter-gated ion-channel ligand binding domain |
7.4E-97 |
NP_492429.2 |
4 |
231-253,260-282,292-314,529-551 |
C31H5.3 |
4 |
231-253,260-282,292-314,529-551 |
SNAP00000044187 |
4 |
153-175,182-204,214-236,451-473 |
GENEFINDER00000044196 |
5 |
95-114,361-383,390-412,422-444,659-681 | |
Sequence |
|
>C. ELEGANS:193424_AT
gaacgtcctgatgttcttgaactttctgtacatggagcacattatgcgtctgacaataaa
aaaaaacaacgtcaatacctaatagaagtggagagacatattctaacccgtccaaatgga
aatggacattcagcagttgataaagcagtgcatcttgacttatcaactggtaatccacac
tctgatgctaaaaaatcatcaccttctccaaaacgaacaagtgcttcaataatgggtatg
actggattgccaacaactcaaatgaatggagcattggattcttcaattaataaatatact
tgtacaaaagttacgcgtccactggaaaacggttcagcaacaataaatcacaaatcatca
cctcaaataaatccaatcaataacaataatatctataaatgtgcaaacaaccaaaagact
caattcgaagatcgtcattttcatcatattctgaatgagcttcgtgttatatcagctcgt
gtgagaaaagaagaagcaatgcatgcacttcaagctgattggatgtttgcaagtcgagtt
gtagatcgggtttgttttcttgctttttcagcatttctcttcatgtgcactgcta
BLASTn GenBank NR |
|
|
|
|
|
|
GAACGTCCTGATGTTCTTGAACTTT |
52 |
349 |
1066 |
Antisense |
GGAGCACATTATGCGTCTGACAATA |
162 |
519 |
1099 |
Antisense |
GGAGAGACATATTCTAACCCGTCCA |
112 |
519 |
1155 |
Antisense |
AAGCAGTGCATCTTGACTTATCAAC |
357 |
151 |
1208 |
Antisense |
ACTGGTAATCCACACTCTGATGCTA |
99 |
95 |
1231 |
Antisense |
GCTAAAAAATCATCACCTTCTCCAA |
477 |
301 |
1252 |
Antisense |
GTACAAAAGTTACGCGTCCACTGGA |
165 |
461 |
1367 |
Antisense |
AAATCACAAATCATCACCTCAAATA |
514 |
117 |
1410 |
Antisense |
GCTTCGTGTTATATCAGCTCGTGTG |
153 |
307 |
1524 |
Antisense |
GTAGATCGGGTTTGTTTTCTTGCTT |
410 |
455 |
1606 |
Antisense |
GCATTTCTCTTCATGTGCACTGCTA |
219 |
309 |
1636 |
Antisense | |
|
Affymetrix Proprietary Database | |