|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
193348_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.3548
|
|
Exemplar sequence
|
|
ZK945.2 NCBI
|
|
ZK945.2 /REP_DB=WormBase Gene ID /WP=CE01733 /GEN=pas-7 /TR=SW:Q09583 /GB=CAA88436.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation /DEF=proteasome component (A-type)
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_063776(11) |
|
|
|
|
|
NM_063776 NCBI |
Caenorhabditis elegans Proteasome Alpha Subunit family member (pas-7) (pas-7) mRNA, complete cds. |
11/11 |
None |
SNAP00000015333 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:10098918:10099764:-1 |
11/11 |
None |
GENEFINDER00000015345 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:10098918:10099764:-1 |
11/11 |
None |
ZK945.2.2 ENSEMBL |
cdna:known chromosome:CEL140:II:10098721:10099765:-1 gene:ZK945.2 |
11/11 |
None |
ZK945.2.1 ENSEMBL |
cdna:known chromosome:CEL140:II:10098721:10099778:-1 gene:ZK945.2 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:10098883-10099761(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
proteasome component (A-type)
|
|
pas-7
|
|
ZK945.2
|
|
174571 Entrez gene
|
|
Q09583 EMBL-EBI
|
|
CE36420 Wormbase
|
Functional Annotations |
|
|
|
|
CANINE:1593251_AT |
similar to proteasome alpha 3 subunit isoform 2 |
cfa |
CANINE:1584430_S_AT |
similar to proteasome alpha 3 subunit isoform 2 |
cfa |
CANINE_2:CFA.4336.1.S1_S_AT |
similar to proteasome alpha 3 subunit isoform 2 |
cfa |
CANINE_2:CFA.4336.2.S1_A_AT |
similar to proteasome alpha 3 subunit isoform 2 |
cfa |
DROSOPHILA_2:1634795_A_AT |
Proteasome 7 subunit |
dm |
DROSGENOME1:142853_AT |
Proteasome 7 subunit |
dm |
CHICKEN:GGAAFFX.11855.1.S1_S_AT |
proteasome (prosome, macropain) subunit, alpha type, 3 |
gga |
HG-U133_PLUS_2:232648_AT |
proteasome (prosome, macropain) subunit, alpha type, 3 |
hs |
HG-U133B:232648_AT |
proteasome (prosome, macropain) subunit, alpha type, 3 |
hs |
HG-U95AV2:1448_AT |
proteasome (prosome, macropain) subunit, alpha type, 3 |
hs |
HC-G110:1448_AT |
proteasome (prosome, macropain) subunit, alpha type, 3 |
hs |
HUGENEFL:D00762_AT |
proteasome (prosome, macropain) subunit, alpha type, 3 |
hs |
HG-U133A:201532_AT |
proteasome (prosome, macropain) subunit, alpha type, 3 |
hs |
HG-U133_PLUS_2:201532_AT |
proteasome (prosome, macropain) subunit, alpha type, 3 |
hs |
HG-FOCUS:201532_AT |
proteasome (prosome, macropain) subunit, alpha type, 3 |
hs |
HG-U133A_2:201532_AT |
proteasome (prosome, macropain) subunit, alpha type, 3 |
hs |
U133_X3P:G4506182_3P_AT |
proteasome (prosome, macropain) subunit, alpha type, 3 |
hs |
U133_X3P:HS.270791.0.A1_3P_AT |
proteasome (prosome, macropain) subunit, alpha type, 3 |
hs |
HG-U95E:85203_AT |
proteasome (prosome, macropain) subunit, alpha type, 3 |
hs |
HU35KSUBA:AA348809_AT |
Proteasome (prosome, macropain) subunit, alpha type, 3 |
hs |
HU35KSUBC:RC_R77952_AT |
Proteasome (prosome, macropain) subunit, alpha type, 3 |
hs |
HG-U133_PLUS_2:237300_AT |
Proteasome (prosome, macropain) subunit, alpha type, 3 |
hs |
HG-U133B:237300_AT |
Proteasome (prosome, macropain) subunit, alpha type, 3 |
hs |
HG-U95E:81879_AT |
Proteasome (prosome, macropain) subunit, alpha type, 3 |
hs |
HG-U95D:88326_AT |
Proteasome (prosome, macropain) subunit, alpha type, 3 |
hs |
HU35KSUBC:RC_C20657_AT |
Proteasome (prosome, macropain) subunit, alpha type, 3 |
hs |
U133_X3P:HS.125702.0.A1_3P_AT |
Proteasome (prosome, macropain) subunit, alpha type, 3 |
hs |
MU11KSUBA:AA690872_F_AT |
proteasome (prosome, macropain) subunit, alpha type 3 |
mm |
MU11KSUBA:C80757_RC_F_AT |
proteasome (prosome, macropain) subunit, alpha type 3 |
mm |
MG-U74AV2:92544_F_AT |
proteasome (prosome, macropain) subunit, alpha type 3 |
mm |
MG-U74CV2:166835_AT |
proteasome (prosome, macropain) subunit, alpha type 3 |
mm |
MOE430A:1448442_A_AT |
proteasome (prosome, macropain) subunit, alpha type 3 |
mm |
MOUSE430A_2:1448442_A_AT |
proteasome (prosome, macropain) subunit, alpha type 3 |
mm |
MOUSE430_2:1448442_A_AT |
proteasome (prosome, macropain) subunit, alpha type 3 |
mm |
MG-U74CV2:135435_AT |
Proteasome subunit C8 (Psma3) |
mm |
MOE430B:1441707_AT |
Proteasome subunit C8 (Psma3) |
mm |
MOUSE430_2:1441707_AT |
Proteasome subunit C8 (Psma3) |
mm |
MU19KSUBA:TC15610_F_AT |
Proteasome subunit C8 (Psma3) |
mm |
MU19KSUBC:TC38867_F_AT |
Proteasome subunit C8 (Psma3) |
mm |
RN-U34:D90258_S_AT |
proteasome (prosome, macropain) subunit, alpha type 3 |
rn |
RG-U34A:D90258_S_AT |
proteasome (prosome, macropain) subunit, alpha type 3 |
rn |
RG-U34B:RC_AI008546_AT |
proteasome (prosome, macropain) subunit, alpha type 3 |
rn |
RAE230A:1368507_AT |
proteasome (prosome, macropain) subunit, alpha type 3 |
rn |
RAT230_2:1368507_AT |
proteasome (prosome, macropain) subunit, alpha type 3 |
rn |
RAE230A:1368508_AT |
proteasome (prosome, macropain) subunit, alpha type 3 |
rn |
RAT230_2:1368508_AT |
proteasome (prosome, macropain) subunit, alpha type 3 |
rn |
RG-U34B:RC_AA849028_AT |
Proteasome subunit alpha type 3-like |
rn |
RG-U34B:RC_AI059664_AT |
Proteasome subunit alpha type 3-like |
rn |
YEAST_2:1776223_AT |
20S proteasome alpha-type subunit |
Sc | |
|
|
|
|
|
6511 |
ubiquitin-dependent protein catabolism |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5839 |
proteasome core complex (sensu Eukaryota) |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
4175 |
endopeptidase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAA88436 |
Hypothetical protein ZK945.2 [Caenorhabditis elegans] ref|NP_496177.2| Proteasome Alpha Subunit family member (pas-7) [Caenorhabditis elegans] sp|Q09583|PSA3_CAEEL Proteasome subunit alpha type 3 (Proteasome subunit alpha 7) |
1.0E-124 |
blast |
CAE67821 |
Hypothetical protein CBG13401 [Caenorhabditis briggsae] |
1.0E-116 | |
|
|
|
|
|
Pfam |
IPR001353 EMBL-EBI |
Peptidase T1, 20S proteasome |
5.4E-51 | |
Sequence |
|
>C. ELEGANS:193348_S_AT
gctgatctcttccaaactttacactgataacgctaatccaagaatgtttaacgtgaacga
caatgttggtgtcgcagttgctggaaactatccagatggtttcgctctgaagaactatgc
ttacggagaagcaatgaagtggctcaaagactaccgtgagccaatgccgattcagaatat
tgctaactcagttgctgagtacattcacattcacactctcggcattagtcgtccgtttgg
agcaggagccttcttcatgtcatggaacaaacaaactggaggacgtcttttccttgtgga
gccatcaggtctaaactatgaatacaaggcatgggctgtcggaaaacatcgccaagccgc
aaaagctgagattgagaagctgaagatcgaggagctggatgtgaatcaactcgtgaagga
agctgctcgaatcattatggtggtgcgtgacgagaacaaggataaaaacgttcaaatcga
aatgggatgggtcggtgagcagacgaacggaaagtacgaagaagttccaagcgaggttgt
cactgctgcc
BLASTn GenBank NR |
|
|
|
|
|
|
GCTGATCTCTTCCAAACTTTACACT |
358 |
295 |
168 |
Antisense |
ACAATGTTGGTGTCGCAGTTGCTGG |
64 |
113 |
227 |
Antisense |
TACCGTGAGCCAATGCCGATTCAGA |
15 |
651 |
319 |
Antisense |
GAGTACATTCACATTCACACTCTCG |
283 |
399 |
364 |
Antisense |
CACACTCTCGGCATTAGTCGTCCGT |
282 |
195 |
379 |
Antisense |
GGAGCCTTCTTCATGTCATGGAACA |
250 |
521 |
412 |
Antisense |
AACTGGAGGACGTCTTTTCCTTGTG |
60 |
137 |
441 |
Antisense |
TTTCCTTGTGGAGCCATCAGGTCTA |
48 |
665 |
456 |
Antisense |
GGCATGGGCTGTCGGAAAACATCGC |
22 |
537 |
495 |
Antisense |
GAAAACATCGCCAAGCCGCAAAAGC |
511 |
355 |
509 |
Antisense |
TCCAAGCGAGGTTGTCACTGCTGCC |
446 |
587 |
693 |
Antisense | |
|
Affymetrix Proprietary Database | |