|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
193262_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.2089
|
|
Exemplar sequence
|
|
F21F3.5 NCBI
|
|
F21F3.5 /REP_DB=WormBase Gene ID /WP=CE24908 /GEN=unc-38 /TR=SW:Q23022 /GB=AAB42282.1 /SUBMIT=ST.LOUIS /CHR=1 /FEA=Sanger Annotation /DEF=ligand-gated ionic channel
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_059071(11) |
|
|
|
|
|
NM_059071 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-38) (unc-38) mRNA, complete cds. |
11/11 |
None |
GENEFINDER00000035681 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:I:4897692:4900901:-1 |
11/11 |
None |
SNAP00000035672 ENSEMBL |
cdna:SNAP chromosome:CEL140:I:4897823:4900901:-1 |
9/11 |
None |
F21F3.5 ENSEMBL |
cdna:known chromosome:CEL140:I:4897641:4900978:-1 gene:F21F3.5 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:4897691-4900901(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
ligand-gated ionic channel
|
|
unc-38
|
|
F21F3.5
|
|
172105 Entrez gene
|
|
CE24908 Wormbase
|
Functional Annotations |
|
|
|
|
CANINE_2:CFAAFFX.3473.1.S1_AT |
similar to cholinergic receptor, nicotinic, alpha polypeptide 3 |
cfa |
CANINE_2:CFAAFFX.3473.1.S1_S_AT |
similar to cholinergic receptor, nicotinic, alpha polypeptide 3 |
cfa |
CANINE_2:CFAAFFX.3505.1.S1_S_AT |
similar to cholinergic receptor, nicotinic, alpha polypeptide 3 |
cfa |
CANINE_2:CFAAFFX.3509.1.S1_AT |
similar to cholinergic receptor, nicotinic, alpha polypeptide 3 |
cfa |
DROSOPHILA_2:1632060_AT |
nicotinic Acetylcholine Receptor alpha 96Aa |
dm |
DROSGENOME1:143056_AT |
nicotinic Acetylcholine Receptor alpha 96Aa |
dm |
CHICKEN:GGA.5095.1.S1_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
gga |
HG-U133_PLUS_2:211587_X_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
hs |
HG-U133A:211587_X_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
hs |
HG-U133A_2:211587_X_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
hs |
HG-U133_PLUS_2:211772_X_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
hs |
HG-U133A:211772_X_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
hs |
HG-U133A_2:211772_X_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
hs |
HG-U133_PLUS_2:210221_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
hs |
HG-U133A:210221_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
hs |
HG-FOCUS:210221_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
hs |
HG-U133A_2:210221_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
hs |
HU35KSUBA:U62432_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
hs |
HUGENEFL:U62432_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
hs |
HU35KSUBC:RC_R85529_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
hs |
HUGENEFL:M86383_S_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
hs |
HUGENEFL:M37981_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
hs |
U133_X3P:G13543945_3P_S_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
hs |
U133_X3P:G12653482_3P_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
hs |
HG-U95AV2:34019_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
hs |
HG-U95C:54403_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
hs |
MOE430A:1452010_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
mm |
MOUSE430A_2:1452010_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
mm |
MOUSE430_2:1452010_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
mm |
MOE430A:1455931_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
mm |
MOUSE430A_2:1455931_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
mm |
MOUSE430_2:1455931_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
mm |
MG-U74BV2:108337_AT |
Cholinergic receptor, nicotinic, alpha polypeptide 3 (Chrna3), mRNA |
mm |
MOE430B:1444368_AT |
Cholinergic receptor, nicotinic, alpha polypeptide 3 (Chrna3), mRNA |
mm |
MOUSE430_2:1444368_AT |
Cholinergic receptor, nicotinic, alpha polypeptide 3 (Chrna3), mRNA |
mm |
MU11KSUBB:MSA.31159.0_S_AT |
Cholinergic receptor, nicotinic, alpha polypeptide 3 (Chrna3), mRNA |
mm |
RN-U34:L31621_S_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
rn |
RG-U34A:L31621_S_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
rn |
RAE230A:1369001_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
rn |
RAT230_2:1369001_AT |
cholinergic receptor, nicotinic, alpha polypeptide 3 |
rn | |
|
|
|
|
|
6810 |
transport |
inferred from electronic annotation |
QuickGO AmiGO |
6811 |
ion transport |
inferred from electronic annotation |
QuickGO AmiGO |
7274 |
neuromuscular synaptic transmission |
inferred from direct assay |
QuickGO AmiGO |
|
|
|
|
16020 |
membrane |
inferred from electronic annotation |
QuickGO AmiGO |
16021 |
integral to membrane |
inferred from electronic annotation |
QuickGO AmiGO |
45211 |
postsynaptic membrane |
inferred from electronic annotation |
QuickGO AmiGO |
45202 |
synapse |
inferred from direct assay |
QuickGO AmiGO |
|
|
|
|
4889 |
nicotinic acetylcholine-activated cation-selective channel activity |
inferred from electronic annotation |
QuickGO AmiGO |
5216 |
ion channel activity |
inferred from electronic annotation |
QuickGO AmiGO |
5230 |
extracellular ligand-gated ion channel activity |
inferred from electronic annotation |
QuickGO AmiGO |
30594 |
neurotransmitter receptor activity |
inferred from electronic annotation |
QuickGO AmiGO |
15464 |
acetylcholine receptor activity |
inferred from direct assay |
QuickGO AmiGO | |
|
|
|
|
|
blast |
AAB42282 |
Uncoordinated protein 38 [Caenorhabditis elegans] emb|CAA67197.1| alpha nicotinic acetylcholine receptor subunit [Caenorhabditis elegans] emb|CAA67196.1| alpha nicotinic acetylcholine receptor subunit [Caenorhabditis elegans] ref|NP_491472.1| UNCoordinated family member (unc-38) [Caenorhabditis elegans] sp|Q23022|ACH5_CAEEL Acetylcholine receptor, alpha-type subunit unc-38 precursor (Uncoordinated protein 38) |
0.0 |
blast |
T25720 |
hypothetical protein F21F3.5 - Caenorhabditis elegans |
0.0 |
blast |
CAE73110 |
Hypothetical protein CBG20491 [Caenorhabditis briggsae] |
0.0 | |
|
|
|
|
|
Pfam |
IPR006029 EMBL-EBI |
Neurotransmitter-gated ion-channel transmembrane region |
9.8E-64 |
Pfam |
IPR006029 EMBL-EBI |
Neurotransmitter-gated ion-channel transmembrane region |
4.8E-23 |
Pfam |
IPR006202 EMBL-EBI |
Neurotransmitter-gated ion-channel ligand binding domain |
3.8E-99 |
NP_491472.1 |
4 |
260-282,289-311,324-346,465-487 |
F21F3.5 |
4 |
260-282,289-311,324-346,465-487 |
GENEFINDER00000035681 |
4 |
260-282,289-311,324-346,465-487 |
SNAP00000035672 |
5 |
4-21,258-280,295-317,324-346,461-483 | |
Sequence |
|
>C. ELEGANS:193262_AT
ctgctcactgaaatcattccggccacatcgatcacgttgccactgattggaaaatatcta
ctgttcacaatggtgatggttacactttctgtcgtggttactgttatttcattaaacttg
catttccgtactccaacaacccatttgatgcctaattgggtgaagaaagtattcctaaaa
tggcttccaaaacttcttttcatgagacgaccaatcgatgattacgaggaaaaattcgat
gataaaaagaagccgaaagacgggaaaattgcattgagcgttcatgcacatcgagtttca
aatgttggaaataacattaggaatgcaacaattgatgacacaattcaaaaaatgtattat
tctccgccagttgtaaaagctttcgaaaatatttgctttatcgccgaactgctgaaaaag
aaagatcgagacgataaaatcgatgaggattggaaatacgtggcaatggtccttgatcga
cttttccttcttattttctcaattgcttgttttgtaggaacagttataattcttttgagg
gcaccaacactgtatgacacacgacaacccatcgatttgc
BLASTn GenBank NR |
|
|
|
|
|
|
CTGCTCACTGAAATCATTCCGGCCA |
33 |
239 |
925 |
Antisense |
ACATCGATCACGTTGCCACTGATTG |
470 |
105 |
949 |
Antisense |
GGTTACACTTTCTGTCGTGGTTACT |
607 |
501 |
1002 |
Antisense |
TTAAACTTGCATTTCCGTACTCCAA |
341 |
683 |
1036 |
Antisense |
GTACTCCAACAACCCATTTGATGCC |
704 |
457 |
1052 |
Antisense |
GAGCGTTCATGCACATCGAGTTTCA |
263 |
387 |
1200 |
Antisense |
AAATGTATTATTCTCCGCCAGTTGT |
599 |
119 |
1274 |
Antisense |
AATATTTGCTTTATCGCCGAACTGC |
627 |
173 |
1312 |
Antisense |
AATGGTCCTTGATCGACTTTTCCTT |
603 |
153 |
1389 |
Antisense |
GGGCACCAACACTGTATGACACACG |
608 |
493 |
1463 |
Antisense |
GACACACGACAACCCATCGATTTGC |
43 |
367 |
1480 |
Antisense | |
|
Affymetrix Proprietary Database | |