|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
193233_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.1016
|
|
Exemplar sequence
|
|
C01A2.3 NCBI
|
|
C01A2.3 /REP_DB=WormBase Gene ID /WP=CE07785 /TR=O02207 /GB=CAB02698.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation /DEF=cytochrome oxidase biogenesis protein like
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_060955(11) |
|
|
|
|
|
NM_060955 NCBI |
Caenorhabditis elegans C01A2.3 (C01A2.3) mRNA, complete cds. |
11/11 |
None |
GENEFINDER00000025739 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:I:13395384:13399087:1 |
11/11 |
None |
SNAP00000025717 ENSEMBL |
cdna:SNAP chromosome:CEL140:I:13395951:13402048:1 |
11/11 |
None |
C01A2.3 ENSEMBL |
cdna:known chromosome:CEL140:I:13395938:13399569:1 gene:C01A2.3 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:13395881-13398100(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
cytochrome oxidase biogenesis protein like
|
|
C01A2.3
|
|
173207 Entrez gene
|
|
O02207 EMBL-EBI
|
|
CE38582 Wormbase
|
Functional Annotations |
|
|
|
|
ATGENOME1:13503_AT |
OXA1 protein, putative |
at |
ATH1-121501:263778_AT |
OXA1 protein, putative |
at |
CANINE:1591536_AT |
similar to Inner membrane protein OXA1L, mitochondrial precursor (Oxidase assembly 1-like protein) (OXA1-like protein) (OXA1Hs) (Hsa) |
cfa |
CANINE:1589342_X_AT |
similar to Inner membrane protein OXA1L, mitochondrial precursor (Oxidase assembly 1-like protein) (OXA1-like protein) (OXA1Hs) (Hsa) |
cfa |
CANINE:1587993_X_AT |
similar to Inner membrane protein OXA1L, mitochondrial precursor (Oxidase assembly 1-like protein) (OXA1-like protein) (OXA1Hs) (Hsa) |
cfa |
CANINE:1585706_X_AT |
similar to Inner membrane protein OXA1L, mitochondrial precursor (Oxidase assembly 1-like protein) (OXA1-like protein) (OXA1Hs) (Hsa) |
cfa |
CANINE:1586054_X_AT |
similar to Inner membrane protein OXA1L, mitochondrial precursor (Oxidase assembly 1-like protein) (OXA1-like protein) (OXA1Hs) (Hsa) |
cfa |
CANINE_2:CFA.1499.1.A1_AT |
similar to Inner membrane protein OXA1L, mitochondrial precursor (Oxidase assembly 1-like protein) (OXA1-like protein) (OXA1Hs) (Hsa) |
cfa |
CANINE_2:CFAAFFX.17401.1.S1_AT |
similar to Inner membrane protein OXA1L, mitochondrial precursor (Oxidase assembly 1-like protein) (OXA1-like protein) (OXA1Hs) (Hsa) |
cfa |
CANINE_2:CFAAFFX.17401.1.S1_S_AT |
similar to Inner membrane protein OXA1L, mitochondrial precursor (Oxidase assembly 1-like protein) (OXA1-like protein) (OXA1Hs) (Hsa) |
cfa |
DROSOPHILA_2:1627726_A_AT |
|
dm |
DROSGENOME1:151840_AT |
|
dm |
HG-U133_PLUS_2:208717_AT |
oxidase (cytochrome c) assembly 1-like |
hs |
HG-U133A:208717_AT |
oxidase (cytochrome c) assembly 1-like |
hs |
HG-FOCUS:208717_AT |
oxidase (cytochrome c) assembly 1-like |
hs |
HG-U133A_2:208717_AT |
oxidase (cytochrome c) assembly 1-like |
hs |
HUGENEFL:X80695_AT |
oxidase (cytochrome c) assembly 1-like |
hs |
U133_X3P:G12804516_3P_AT |
oxidase (cytochrome c) assembly 1-like |
hs |
HG-U95AV2:39774_AT |
oxidase (cytochrome c) assembly 1-like |
hs |
MU11KSUBA:AA734412_AT |
oxidase assembly 1-like |
mm |
MG-U74BV2:109683_AT |
oxidase assembly 1-like |
mm |
MG-U74CV2:169926_AT |
oxidase assembly 1-like |
mm |
MOE430A:1423738_AT |
oxidase assembly 1-like |
mm |
MOUSE430A_2:1423738_AT |
oxidase assembly 1-like |
mm |
MOUSE430_2:1423738_AT |
oxidase assembly 1-like |
mm |
MOE430A:1451088_A_AT |
oxidase assembly 1-like |
mm |
MOUSE430A_2:1451088_A_AT |
oxidase assembly 1-like |
mm |
MOUSE430_2:1451088_A_AT |
oxidase assembly 1-like |
mm |
MOE430B:1456845_AT |
Oxidase assembly 1-like, mRNA (cDNA clone MGC:28641 IMAGE:4223847) |
mm |
MOUSE430_2:1456845_AT |
Oxidase assembly 1-like, mRNA (cDNA clone MGC:28641 IMAGE:4223847) |
mm |
MU19KSUBA:TC20791_S_AT |
Oxidase assembly 1-like, mRNA (cDNA clone MGC:28641 IMAGE:4223847) |
mm |
MU19KSUBB:TC27889_AT |
Oxidase assembly 1-like, mRNA (cDNA clone MGC:28641 IMAGE:4223847) |
mm |
MU19KSUBB:TC30531_AT |
Oxidase assembly 1-like, mRNA (cDNA clone MGC:28641 IMAGE:4223847) |
mm |
RAE230A:1372291_AT |
similar to Oxa1l protein |
rn |
RAT230_2:1372291_AT |
similar to Oxa1l protein |
rn |
YEAST_2:1773053_AT |
Translocase of the mitochondrial inner membrane, mediates the insertion of both mitochondrial- and nuclear-encoded proteins from the matrix into the inner membrane, interacts with mitochondrial ribosomes; null is respiratory deficient |
Sc | |
|
|
|
|
|
blast |
CAB02698 |
Hypothetical protein C01A2.3 [Caenorhabditis elegans] ref|NP_493356.2| C01A2.3 [Caenorhabditis elegans] |
0.0 |
blast |
T18794 |
hypothetical protein C01A2.3 - Caenorhabditis elegans |
1.0E-180 |
blast |
T18794 |
hypothetical protein C01A2.3 - Caenorhabditis elegans |
1.0E-171 |
blast |
CAB02698 |
Hypothetical protein C01A2.3 [Caenorhabditis elegans] ref|NP_493356.2| C01A2.3 [Caenorhabditis elegans] |
1.0E-171 |
blast |
CAE73029 |
Hypothetical protein CBG20396 [Caenorhabditis briggsae] |
1.0E-146 |
blast |
CAE73029 |
Hypothetical protein CBG20396 [Caenorhabditis briggsae] |
1.0E-144 | |
|
|
|
|
|
Pfam |
IPR001708 EMBL-EBI |
60 kDa inner membrane protein |
1.5E-10 |
Pfam |
IPR001708 EMBL-EBI |
60 kDa inner membrane protein |
1.5E-10 |
Pfam |
IPR005024 EMBL-EBI |
Snf7 |
5.9E-43 |
NP_493356.2 |
4 |
104-126,183-200,228-247,267-289 |
C01A2.3 |
4 |
104-126,183-200,228-247,267-289 |
GENEFINDER00000025739 |
4 |
143-165,222-239,267-286,306-328 |
SNAP00000025717 |
4 |
104-126,183-200,228-247,267-289 | |
Sequence |
|
>C. ELEGANS:193233_AT
ggagctgtatttgctactcaattctttgcaattaaaaagatggtagttgtcaattatcct
ggattatctactggtggaacattatggtttactgatttaacagcaactgatccatattat
gcacttccattcatctctgcagctactatggctttggtgacaaaagttggaattgaaatg
ggtacatcagctgatcaaatgccaccaattatgcgtgcatttatgacttatggtcttcct
gttgttatttttggagtttcttcacaatttgctacgggtctatgcgtatattggacagct
tccaacgctgtttcgttgatctacgcggccgcattcaaagttgacgcgattcgaaaaata
tttggaattccaccagttgtaccacttccaccgagtgccgtccaaaagaatgccatct
BLASTn GenBank NR |
|
|
|
|
|
|
GGAGCTGTATTTGCTACTCAATTCT |
14 |
521 |
580 |
Antisense |
ATATTATGCACTTCCATTCATCTCT |
543 |
19 |
693 |
Antisense |
CATTCATCTCTGCAGCTACTATGGC |
207 |
217 |
707 |
Antisense |
ACATCAGCTGATCAAATGCCACCAA |
579 |
105 |
763 |
Antisense |
GACTTATGGTCTTCCTGTTGTTATT |
111 |
373 |
804 |
Antisense |
GTTTCTTCACAATTTGCTACGGGTC |
112 |
451 |
835 |
Antisense |
GGACAGCTTCCAACGCTGTTTCGTT |
333 |
525 |
872 |
Antisense |
CGCTGTTTCGTTGATCTACGCGGCC |
433 |
251 |
885 |
Antisense |
CTACGCGGCCGCATTCAAAGTTGAC |
170 |
225 |
900 |
Antisense |
TGGAATTCCACCAGTTGTACCACTT |
347 |
545 |
942 |
Antisense |
AGTGCCGTCCAAAAGAATGCCATCT |
249 |
61 |
973 |
Antisense | |
|
Affymetrix Proprietary Database |