|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
193173_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.2488
|
|
Exemplar sequence
|
|
ZK909.2B NCBI
|
|
ZK909.2B /REP_DB=WormBase Gene ID /WP=CE15475 /GEN=kin-1 /TR=O18311 /GB=CAB04169.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation /DEF=cAMP-dependant protein kinase
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_170959(11), NM_170961(11), NM_061205(11), NM_170963(11), NM_170965(11), NM_170967(11) |
|
|
|
|
|
NM_170959 NCBI |
Caenorhabditis elegans protein KINase family member (kin-1) (kin-1) mRNA, complete cds. |
11/11 |
A |
NM_170961 NCBI |
Caenorhabditis elegans protein KINase family member (kin-1) (kin-1) mRNA, complete cds. |
11/11 |
A |
NM_061205 NCBI |
Caenorhabditis elegans protein KINase family member (kin-1) (kin-1) mRNA, complete cds. |
11/11 |
A |
NM_170963 NCBI |
Caenorhabditis elegans protein KINase family member (kin-1) (kin-1) mRNA, complete cds. |
11/11 |
A |
NM_170965 NCBI |
Caenorhabditis elegans protein KINase family member (kin-1) (kin-1) mRNA, complete cds. |
11/11 |
A |
NM_170967 NCBI |
Caenorhabditis elegans protein KINase family member (kin-1) (kin-1) mRNA, complete cds. |
11/11 |
A |
SNAP00000000349 ENSEMBL |
cdna:SNAP chromosome:CEL140:I:14956801:14959685:1 |
11/11 |
None |
ZK909.2j ENSEMBL |
cdna:known chromosome:CEL140:I:14927653:14959569:1 gene:ZK909.2 |
11/11 |
A |
ZK909.2i ENSEMBL |
cdna:known chromosome:CEL140:I:14931095:14959187:1 gene:ZK909.2 |
11/11 |
A |
ZK909.2b ENSEMBL |
cdna:known chromosome:CEL140:I:14941922:14959187:1 gene:ZK909.2 |
11/11 |
A |
ZK909.2k ENSEMBL |
cdna:known chromosome:CEL140:I:14942951:14959187:1 gene:ZK909.2 |
11/11 |
A |
ZK909.2e ENSEMBL |
cdna:known chromosome:CEL140:I:14945108:14959187:1 gene:ZK909.2 |
11/11 |
A |
ZK909.2d ENSEMBL |
cdna:known chromosome:CEL140:I:14948456:14959187:1 gene:ZK909.2 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
|
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:14941952-14959118(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
ZK909.2
|
Functional Annotations |
|
|
|
|
|
blast |
CAD45621 |
Hypothetical protein ZK909.2j [Caenorhabditis elegans] emb|CAD45588.1| Hypothetical protein ZK909.2j [Caenorhabditis elegans] ref|NP_740955.1| protein KINase family member (kin-1) [Caenorhabditis elegans] |
0.0 |
blast |
CAD45622 |
Hypothetical protein ZK909.2k [Caenorhabditis elegans] emb|CAD45589.1| Hypothetical protein ZK909.2k [Caenorhabditis elegans] ref|NP_740959.1| protein KINase family member (kin-1) [Caenorhabditis elegans] |
0.0 |
blast |
CAD45616 |
Hypothetical protein ZK909.2e [Caenorhabditis elegans] emb|CAD45583.1| Hypothetical protein ZK909.2e [Caenorhabditis elegans] ref|NP_740961.1| protein KINase family member (kin-1) [Caenorhabditis elegans] sp|P21137|KAPC_CAEEL cAMP-dependent protein kinase catalytic subunit (PKA C) |
0.0 |
blast |
CAD45620 |
Hypothetical protein ZK909.2i [Caenorhabditis elegans] emb|CAD45587.1| Hypothetical protein ZK909.2i [Caenorhabditis elegans] ref|NP_740957.1| protein KINase family member (kin-1) [Caenorhabditis elegans] |
0.0 |
blast |
CAB05035 |
Hypothetical protein ZK909.2b [Caenorhabditis elegans] emb|CAB04169.1| Hypothetical protein ZK909.2b [Caenorhabditis elegans] ref|NP_493606.1| protein KINase family member (kin-1) [Caenorhabditis elegans] |
0.0 |
blast |
AAA51610 |
cAMP-dependent protein kinase catalytic subunit C [Caenorhabditis elegans] |
0.0 |
blast |
CAE72620 |
Hypothetical protein CBG19814 [Caenorhabditis briggsae] |
0.0 | |
|
|
|
|
|
ec |
A2S7_HUMAN |
(Q96Q40) Serine/threonine-protein kinase ALS2CR7 (EC 2.7.1.37) (Amyotrophic lateral sclerosis 2 chromosomal region candidate gene protein 7) |
1.0E-66 |
ec |
A2S7_HUMAN |
(Q96Q40) Serine/threonine-protein kinase ALS2CR7 (EC 2.7.1.37) (Amyotrophic lateral sclerosis 2 chromosomal region candidate gene protein 7) |
2.0E-68 |
ec |
A2S7_HUMAN |
(Q96Q40) Serine/threonine-protein kinase ALS2CR7 (EC 2.7.1.37) (Amyotrophic lateral sclerosis 2 chromosomal region candidate gene protein 7) |
1.0E-68 |
ec |
A2S7_HUMAN |
(Q96Q40) Serine/threonine-protein kinase ALS2CR7 (EC 2.7.1.37) (Amyotrophic lateral sclerosis 2 chromosomal region candidate gene protein 7) |
9.0E-69 |
ec |
A2S7_HUMAN |
(Q96Q40) Serine/threonine-protein kinase ALS2CR7 (EC 2.7.1.37) (Amyotrophic lateral sclerosis 2 chromosomal region candidate gene protein 7) |
5.0E-69 |
ec |
A2S7_HUMAN |
(Q96Q40) Serine/threonine-protein kinase ALS2CR7 (EC 2.7.1.37) (Amyotrophic lateral sclerosis 2 chromosomal region candidate gene protein 7) |
6.0E-70 |
hanks |
1.1.4 |
AGC group; AGC I Cyclic nucleotide regulated protein kinase (PKA & PKG); EcAPKa |
1.0E-145 |
hanks |
1.1.4 |
AGC group; AGC I Cyclic nucleotide regulated protein kinase (PKA & PKG); EcAPKa |
1.0E-146 |
hanks |
1.1.4 |
AGC group; AGC I Cyclic nucleotide regulated protein kinase (PKA & PKG); EcAPKa |
1.0E-147 |
hanks |
1.1.4 |
AGC group; AGC I Cyclic nucleotide regulated protein kinase (PKA & PKG); EcAPKa |
1.0E-148 | |
|
|
|
|
|
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
5.7E-89 |
Pfam |
IPR000961 EMBL-EBI |
Protein kinase C-terminal domain |
0.011 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
5.7E-89 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
5.7E-89 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
5.7E-89 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
5.7E-89 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
5.7E-89 |
Pfam |
IPR000719 EMBL-EBI |
Protein kinase |
5.7E-89 | |
Sequence |
|
>C. ELEGANS:193173_AT
ccgccctcgttctccaaaggagaatccaatggtcgactgttcgaggctctgtatccacgt
gtcgatggtcccgccgacacacgtcattttgtggaagaggtgcaagagccgactgagttt
gtgatcgccgc
BLASTn GenBank NR |
|
|
|
|
|
|
CCGCCCTCGTTCTCCAAAGGAGAAT |
174 |
1 |
973 |
Antisense |
GGAGAATCCAATGGTCGACTGTTCG |
703 |
519 |
991 |
Antisense |
AATGGTCGACTGTTCGAGGCTCTGT |
257 |
163 |
1000 |
Antisense |
TCGACTGTTCGAGGCTCTGTATCCA |
425 |
601 |
1005 |
Antisense |
ACTGTTCGAGGCTCTGTATCCACGT |
166 |
97 |
1008 |
Antisense |
CCGCCGACACACGTCATTTTGTGGA |
184 |
263 |
1043 |
Antisense |
GACACACGTCATTTTGTGGAAGAGG |
79 |
359 |
1048 |
Antisense |
GTGGAAGAGGTGCAAGAGCCGACTG |
270 |
491 |
1063 |
Antisense |
AGAGGTGCAAGAGCCGACTGAGTTT |
584 |
67 |
1068 |
Antisense |
GCAAGAGCCGACTGAGTTTGTGATC |
271 |
321 |
1074 |
Antisense |
AGCCGACTGAGTTTGTGATCGCCGC |
214 |
83 |
1079 |
Antisense | |
|
Affymetrix Proprietary Database |