|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
193110_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.9117
|
|
Exemplar sequence
|
|
F49E8.5 NCBI
|
|
F49E8.5 /REP_DB=WormBase Gene ID /WP=CE28408 /GEN=dif-1 /TR=Q27257 /GB=AAB03153.2 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation /DEF=mitochondrial carrier family
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq,GenBank identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_068822(11), X76115(11) |
|
|
|
|
|
NM_068822 NCBI |
Caenorhabditis elegans DIFferentiation abnormal family member (dif-1) (dif-1) mRNA, complete cds. |
11/11 |
A |
X76115 NCBI |
C.elegans mRNA for unknown ORF, 1076bp. |
11/11 |
A |
SNAP00000021361 ENSEMBL |
cdna:SNAP chromosome:CEL140:IV:7551722:7552848:-1 |
11/11 |
None |
GENEFINDER00000021366 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:IV:7551722:7552848:-1 |
11/11 |
None |
F49E8.5.1 ENSEMBL |
cdna:known chromosome:CEL140:IV:7551425:7552992:-1 gene:F49E8.5 |
11/11 |
None |
F49E8.5.2 ENSEMBL |
cdna:known chromosome:CEL140:IV:7551534:7552858:-1 gene:F49E8.5 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIV:7551727-7552854(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
mitochondrial carrier family
|
|
dif-1
|
|
F49E8.5
|
|
177530 Entrez gene
|
|
Q27257 EMBL-EBI
|
|
CE28408 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:248838_AT |
mitochondrial carnitine/acyl carrier, putative / a bout de souffle (BOU) / CAC-like protein |
at |
DROSOPHILA_2:1628991_AT |
congested-like trachea |
dm |
DROSGENOME1:142499_AT |
congested-like trachea |
dm |
CHICKEN:GGA.1685.1.S1_AT |
solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 |
gga |
HG-U133_PLUS_2:203658_AT |
solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 |
hs |
HG-U133A:203658_AT |
solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 |
hs |
HG-FOCUS:203658_AT |
solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 |
hs |
HG-U133A_2:203658_AT |
solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 |
hs |
U133_X3P:G12804552_3P_AT |
solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 |
hs |
HG-U95AV2:32376_AT |
solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 |
hs |
HG-U95E:91423_AT |
solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 |
hs |
MU11KSUBA:AA688902_AT |
solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20 |
mm |
MU11KSUBA:AA688902_G_AT |
solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20 |
mm |
MG-U74AV2:95695_AT |
solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20 |
mm |
MOE430A:1423108_AT |
solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20 |
mm |
MOUSE430A_2:1423108_AT |
solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20 |
mm |
MOUSE430_2:1423108_AT |
solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20 |
mm |
MOE430A:1423109_S_AT |
solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20 |
mm |
MOUSE430A_2:1423109_S_AT |
solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20 |
mm |
MOUSE430_2:1423109_S_AT |
solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20 |
mm |
MU19KSUBB:TC33484_S_AT |
Solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20, mRNA (cDNA clone MGC:25786 IMAGE:4019406) |
mm |
RG-U34A:RC_AA800120_AT |
solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 |
rn |
RG-U34C:RC_AI105089_AT |
solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 |
rn |
RAE230A:1398249_AT |
solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 |
rn |
RAT230_2:1398249_AT |
solute carrier family 25 (carnitine/acylcarnitine translocase), member 20 |
rn |
YEAST_2:1774778_AT |
Mitochondrial inner membrane carnitine transporter, required for carnitine-dependent transport of acetyl-CoA from peroxisomes to mitochondria during fatty acid beta-oxidation |
Sc | |
|
|
|
|
|
6810 |
transport |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5743 |
mitochondrial inner membrane |
inferred from electronic annotation |
QuickGO AmiGO |
16020 |
membrane |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5215 |
transporter activity |
inferred from electronic annotation |
QuickGO AmiGO |
5488 |
binding |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
AAB03153 |
Differentiation abnormal protein 1 [Caenorhabditis elegans] ref|NP_501223.1| DIFferentiation abnormal family member (dif-1) [Caenorhabditis elegans] sp|Q27257|DIF1_CAEEL Protein dif-1 emb|CAA53721.1| carrier protein (c1) [Caenorhabditis elegans] emb|CAA88283.1| DIF-1 [Caenorhabditis elegans] |
1.0E-180 |
blast |
CAE61912 |
Hypothetical protein CBG05908 [Caenorhabditis briggsae] |
1.0E-175 | |
|
|
|
|
|
Pfam |
IPR001993 EMBL-EBI |
Mitochondrial substrate carrier |
7.1E-29 |
Pfam |
IPR001993 EMBL-EBI |
Mitochondrial substrate carrier |
5.9E-34 |
Pfam |
IPR001993 EMBL-EBI |
Mitochondrial substrate carrier |
2.0E-29 |
NP_501223.1 |
3 |
5-27,68-90,103-125 |
CAA53721.1 |
3 |
5-27,68-90,103-125 |
F49E8.5.1 |
3 |
5-27,68-90,103-125 |
F49E8.5.2 |
3 |
5-27,68-90,103-125 |
SNAP00000021361 |
3 |
5-27,68-90,103-125 |
GENEFINDER00000021366 |
3 |
5-27,68-90,103-125 | |
Sequence |
|
>C. ELEGANS:193110_AT
gaatcaagtgtcttcttcaagttcagcaagctggatctgctggttctggagttcattacg
atggtccacttgatgttgtcaaaaaactatataaacaaggaggaatttcatcaatctaca
gaggaactggtgccactctgctcagagacatcccagcttcagccgcttatctttcagtat
atgaatatctaaaaaagaaattctctggagaaggagctcaaagaacattgtcaccaggag
caacattgatggctggaggacttgctggtattgccaattggggagtgtgtattccagctg
atgttctcaaatctcgattacaaacagcccctg
BLASTn GenBank NR |
|
|
|
|
|
|
GAATCAAGTGTCTTCTTCAAGTTCA |
227 |
325 |
392 |
Antisense |
TGGATCTGCTGGTTCTGGAGTTCAT |
145 |
551 |
423 |
Antisense |
TACGATGGTCCACTTGATGTTGTCA |
705 |
647 |
448 |
Antisense |
ATCTACAGAGGAACTGGTGCCACTC |
208 |
33 |
505 |
Antisense |
GGTGCCACTCTGCTCAGAGACATCC |
6 |
501 |
520 |
Antisense |
TTCAGCCGCTTATCTTTCAGTATAT |
467 |
687 |
549 |
Antisense |
GAACATTGTCACCAGGAGCAACATT |
228 |
351 |
614 |
Antisense |
GGAGGACTTGCTGGTATTGCCAATT |
690 |
515 |
646 |
Antisense |
GGGGAGTGTGTATTCCAGCTGATGT |
180 |
497 |
671 |
Antisense |
CCAGCTGATGTTCTCAAATCTCGAT |
268 |
273 |
685 |
Antisense |
AAATCTCGATTACAAACAGCCCCTG |
147 |
117 |
700 |
Antisense | |
|
Affymetrix Proprietary Database |