|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
192936_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.2804
|
|
Exemplar sequence
|
|
F28C6.6 NCBI
|
|
F28C6.6 /REP_DB=WormBase Gene ID /WP=CE03277 /GEN=suf-1 /TR=Q19866 /GB=CAA92672.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation /DEF=polyadenylation factor like
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_063424(11) |
|
|
|
|
|
NM_063424 NCBI |
Caenorhabditis elegans SUppressor-of-Forked (Drosophila) homolog family member (suf-1) (suf-1) mRNA, complete cds. |
11/11 |
None |
SNAP00000038095 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:8603783:8606467:1 |
11/11 |
None |
GENEFINDER00000038108 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:8603783:8606467:1 |
11/11 |
None |
F28C6.6.1 ENSEMBL |
cdna:known chromosome:CEL140:II:8603768:8606666:1 gene:F28C6.6 |
11/11 |
None |
F28C6.6.2 ENSEMBL |
cdna:known chromosome:CEL140:II:8603768:8705872:1 gene:F28C6.6 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:8603779-8606464(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
polyadenylation factor like
|
|
suf-1
|
|
F28C6.6
|
|
174380 Entrez gene
|
|
Q19866 EMBL-EBI
|
|
CE03277 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:259401_AT |
suppressor of forked protein family protein / SUF family protein |
at |
CANINE:1604474_AT |
similar to cleavage stimulation factor subunit 3 |
cfa |
CANINE:1586172_AT |
similar to cleavage stimulation factor subunit 3 |
cfa |
CANINE:1584703_S_AT |
similar to cleavage stimulation factor subunit 3 |
cfa |
CANINE_2:CFA.3343.1.A1_AT |
similar to cleavage stimulation factor subunit 3 |
cfa |
CANINE_2:CFA.3343.1.A1_S_AT |
similar to cleavage stimulation factor subunit 3 |
cfa |
CANINE_2:CFA.474.1.S1_AT |
similar to cleavage stimulation factor subunit 3 |
cfa |
CANINE_2:CFAAFFX.11792.1.S1_S_AT |
similar to cleavage stimulation factor subunit 3 |
cfa |
CHICKEN:GGAAFFX.7445.1.S1_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
gga |
CHICKEN:GGAAFFX.7445.2.S1_S_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
gga |
HG-U133_PLUS_2:229666_S_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
hs |
HG-U133B:229666_S_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
hs |
HG-U133_PLUS_2:203947_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
hs |
HG-U133A:203947_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
hs |
HG-FOCUS:203947_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
hs |
HG-U133A_2:203947_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
hs |
HG-U95AV2:41183_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
hs |
HUGENEFL:U15782_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
hs |
U133_X3P:G4557494_3P_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
hs |
U133_X3P:HS.180034.1.S1_3P_X_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
hs |
U133_X3P:HS.180034.1.S1_3P_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
hs |
U133_X3P:HS.180034.1.S1_3P_A_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
hs |
HG-U133_PLUS_2:229665_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
hs |
HG-U133B:229665_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
hs |
HG-U95B:43440_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
hs |
HG-U95B:43441_G_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
hs |
HG-U95C:60877_R_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
hs |
HG-U95B:44996_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
hs |
HU35KSUBC:RC_N32907_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
hs |
U133_X3P:229665_3P_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |
hs |
MU11KSUBA:AA265357_F_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3 |
mm |
MU11KSUBA:C79534_RC_F_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3 |
mm |
MG-U74AV2:100968_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3 |
mm |
MG-U74BV2:116870_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3 |
mm |
MOE430A:1424723_S_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3 |
mm |
MOUSE430A_2:1424723_S_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3 |
mm |
MOUSE430_2:1424723_S_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3 |
mm |
MG-U74CV2:133439_R_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3 (Cstf3), mRNA |
mm |
MOE430B:1443909_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3 (Cstf3), mRNA |
mm |
MOUSE430_2:1443909_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3 (Cstf3), mRNA |
mm |
MU19KSUBB:TC31698_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3 (Cstf3), mRNA |
mm |
MU19KSUBB:TC31698_G_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3 (Cstf3), mRNA |
mm |
MU19KSUBB:TC32336_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3 (Cstf3), mRNA |
mm |
MU19KSUBB:TC32336_G_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3 (Cstf3), mRNA |
mm |
RAE230B:1393166_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa (predicted) |
rn |
RAT230_2:1393166_AT |
cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa (predicted) |
rn |
RAE230B:1384935_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa (predicted) |
rn |
RAT230_2:1384935_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa (predicted) |
rn |
RAE230B:1394996_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa (predicted) |
rn |
RAT230_2:1394996_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa (predicted) |
rn |
RAE230B:1396900_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa (predicted) |
rn |
RAT230_2:1396900_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa (predicted) |
rn |
RAE230B:1397796_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa (predicted) |
rn |
RAT230_2:1397796_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa (predicted) |
rn |
RG-U34B:RC_AA998749_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa (predicted) |
rn |
RG-U34B:RC_AI044234_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa (predicted) |
rn |
RG-U34C:RC_AI070621_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa (predicted) |
rn |
RG-U34B:RC_AI029229_AT |
Cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa (predicted) |
rn |
YEAST_2:1780192_AT |
Cleavage and polyadenylation factor I (CF I) component involved in cleavage and polyadenylation of mRNA 3' ends; bridges interaction between Rna15p and Hrp1p in the CF I complex |
Sc | |
|
|
|
|
|
6396 |
RNA processing |
inferred from electronic annotation |
QuickGO AmiGO |
6397 |
mRNA processing |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5622 |
intracellular |
inferred from electronic annotation |
QuickGO AmiGO |
5634 |
nucleus |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAA92672 |
Hypothetical protein F28C6.6 [Caenorhabditis elegans] ref|NP_495825.1| SUppressor-of-Forked (Drosophila) homolog family member (suf-1) [Caenorhabditis elegans] |
0.0 |
blast |
AAA62311 |
cleavage stimulation factor |
0.0 |
blast |
AAB01508 |
similar to C. elegans cleavage stimulation factor encoded by GenBank Accession Number L39893; Drosophila su(f) homolog, similar to Swiss-Prot Accession Number P25991 |
0.0 | |
|
|
|
|
|
Pfam |
IPR008847 EMBL-EBI |
Suppressor of forked |
1.0E-126 |
Pfam |
IPR008847 EMBL-EBI |
Suppressor of forked |
1.0E-126 | |
Sequence |
|
>C. ELEGANS:192936_S_AT
tacggaaagcatcgccggaccatcattcgttggttcaaagaatgttccaactcatggacc
acaagcagccagtgcaattatgggtggagctggtggacacgcagacgtggcacgatacgg
tttcccaagacccgacatatcacaaatgattccattcaaaccacgagtcaattgtacggc
atcgtttcatccggtacctggaggcgtatttccaccaccacaatcagttgcacatctcat
gtctcttcttcctcctccaacttgttttattggaccatttatcaatgtggaattgttgtg
caatatgatcaataatatgcagcttccaaacgtttcatatccaaagtcagaggacaatat
gcttggcccaatgttggaacaagacgtcaaaaaagatatgtatcaattgttagcaacaac
gtcagatccatcagcagtcgttcgttcatcagctctgtccgatttgaa
BLASTn GenBank NR |
|
|
|
|
|
|
TACGGAAAGCATCGCCGGACCATCA |
508 |
647 |
1638 |
Antisense |
TCATGGACCACAAGCAGCCAGTGCA |
5 |
623 |
1689 |
Antisense |
TGGAGCTGGTGGACACGCAGACGTG |
640 |
547 |
1722 |
Antisense |
TTTCCCAAGACCCGACATATCACAA |
570 |
669 |
1758 |
Antisense |
TGTACGGCATCGTTTCATCCGGTAC |
437 |
559 |
1810 |
Antisense |
CATCCGGTACCTGGAGGCGTATTTC |
449 |
209 |
1825 |
Antisense |
ATCAGTTGCACATCTCATGTCTCTT |
423 |
29 |
1860 |
Antisense |
TAATATGCAGCTTCCAAACGTTTCA |
523 |
635 |
1950 |
Antisense |
AGCAACAACGTCAGATCCATCAGCA |
253 |
77 |
2049 |
Antisense |
TCCATCAGCAGTCGTTCGTTCATCA |
171 |
591 |
2064 |
Antisense |
GTTCATCAGCTCTGTCCGATTTGAA |
197 |
445 |
2081 |
Antisense | |
|
Affymetrix Proprietary Database | |