|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
192934_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.1617
|
|
Exemplar sequence
|
|
C36B1.4 NCBI
|
|
C36B1.4 /REP_DB=WormBase Gene ID /WP=CE05371 /GEN=pas-4 /TR=SW:Q95005 /GB=CAB02269.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation /DEF=proteasome A-type submit
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_059959(11) |
|
|
|
|
|
NM_059959 NCBI |
Caenorhabditis elegans Proteasome Alpha Subunit family member (pas-4) (pas-4) mRNA, complete cds. |
11/11 |
None |
SNAP00000022501 ENSEMBL |
cdna:SNAP chromosome:CEL140:I:8735464:8738588:-1 |
11/11 |
None |
GENEFINDER00000022509 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:I:8735464:8736612:-1 |
11/11 |
None |
C36B1.4.3 ENSEMBL |
cdna:known chromosome:CEL140:I:8735246:8736612:-1 gene:C36B1.4 |
11/11 |
None |
C36B1.4.1 ENSEMBL |
cdna:known chromosome:CEL140:I:8735343:8736622:-1 gene:C36B1.4 |
11/11 |
None |
C36B1.4.2 ENSEMBL |
cdna:known chromosome:CEL140:I:8735343:8736612:-1 gene:C36B1.4 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:8735394-8736543(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
proteasome A-type submit
|
|
pas-4
|
|
C36B1.4
|
|
172679 Entrez gene
|
|
Q95005 EMBL-EBI
|
|
CE05371 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:247080_AT |
20S proteasome alpha subunit D2 (PAD2) (PRS1) (PRC6) |
at |
CANINE:1602360_AT |
proteasome (prosome, macropain) subunit, alpha type, 7 |
cfa |
CANINE_2:CFAAFFX.18873.1.S1_S_AT |
proteasome (prosome, macropain) subunit, alpha type, 7 |
cfa |
CHICKEN:GGA.2045.2.S1_A_AT |
proteasome (prosome, macropain) subunit, alpha type, 7 |
gga |
HG-U133_PLUS_2:201114_X_AT |
proteasome (prosome, macropain) subunit, alpha type, 7 |
hs |
HG-U133A:201114_X_AT |
proteasome (prosome, macropain) subunit, alpha type, 7 |
hs |
HG-U133A_2:201114_X_AT |
proteasome (prosome, macropain) subunit, alpha type, 7 |
hs |
HG-U133_PLUS_2:216088_S_AT |
proteasome (prosome, macropain) subunit, alpha type, 7 |
hs |
HG-U133A_2:216088_S_AT |
proteasome (prosome, macropain) subunit, alpha type, 7 |
hs |
HG-FOCUS:216088_S_AT |
proteasome (prosome, macropain) subunit, alpha type, 7 |
hs |
HG-U133A:216088_S_AT |
proteasome (prosome, macropain) subunit, alpha type, 7 |
hs |
HU35KSUBA:AA313677_AT |
proteasome (prosome, macropain) subunit, alpha type, 7 |
hs |
U133_X3P:HS.233952.3.S1_3P_A_AT |
proteasome (prosome, macropain) subunit, alpha type, 7 |
hs |
HG-U95AV2:33449_AT |
proteasome (prosome, macropain) subunit, alpha type, 7 |
hs |
HU35KSUBC:RC_N57710_AT |
Proteasome (prosome, macropain) subunit, alpha type, 7 |
hs |
HG-U95B:47026_AT |
Proteasome (prosome, macropain) subunit, alpha type, 7 |
hs |
MU11KSUBA:AA592029_S_AT |
proteasome (prosome, macropain) subunit, alpha type 7 |
mm |
MG-U74AV2:93988_AT |
proteasome (prosome, macropain) subunit, alpha type 7 |
mm |
MOE430A:1423568_AT |
proteasome (prosome, macropain) subunit, alpha type 7 |
mm |
MOUSE430A_2:1423568_AT |
proteasome (prosome, macropain) subunit, alpha type 7 |
mm |
MOUSE430_2:1423568_AT |
proteasome (prosome, macropain) subunit, alpha type 7 |
mm |
MOE430A:1423567_A_AT |
proteasome (prosome, macropain) subunit, alpha type 7 |
mm |
MOUSE430A_2:1423567_A_AT |
proteasome (prosome, macropain) subunit, alpha type 7 |
mm |
MOUSE430_2:1423567_A_AT |
proteasome (prosome, macropain) subunit, alpha type 7 |
mm |
MU19KSUBA:TC24584_S_AT |
Proteasome (prosome, macropain) subunit, alpha type 7, mRNA (cDNA clone MGC:6440 IMAGE:2581897) |
mm |
RG-U34A:D30804_G_AT |
proteasome (prosome, macropain) subunit, alpha type 7 |
rn |
RG-U34A:D30804_AT |
proteasome (prosome, macropain) subunit, alpha type 7 |
rn |
RG-U34B:RC_AA925475_AT |
proteasome (prosome, macropain) subunit, alpha type 7 |
rn |
RG-U34C:RC_AI179950_S_AT |
proteasome (prosome, macropain) subunit, alpha type 7 |
rn |
RAE230A:1371869_AT |
proteasome (prosome, macropain) subunit, alpha type 7 |
rn |
RAT230_2:1371869_AT |
proteasome (prosome, macropain) subunit, alpha type 7 |
rn |
RG-U34C:RC_AI072328_AT |
Proteasome (prosome, macropain) subunit, alpha type 7 |
rn |
YEAST_2:1773650_AT |
20S proteasome alpha-type subunit |
Sc | |
|
|
|
|
|
6511 |
ubiquitin-dependent protein catabolism |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5839 |
proteasome core complex (sensu Eukaryota) |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
4175 |
endopeptidase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAB02269 |
Hypothetical protein C36B1.4 [Caenorhabditis elegans] ref|NP_492360.1| Proteasome Alpha Subunit family member (pas-4) [Caenorhabditis elegans] sp|Q95005|PSA7_CAEEL Proteasome subunit alpha type 7 (Proteasome subunit alpha 4) |
1.0E-130 |
blast |
CAE66957 |
Hypothetical protein CBG12349 [Caenorhabditis briggsae] |
1.0E-127 | |
|
|
|
|
|
Pfam |
IPR001353 EMBL-EBI |
Peptidase T1, 20S proteasome |
2.2E-72 |
Pfam |
IPR001353 EMBL-EBI |
Peptidase T1, 20S proteasome |
2.2E-72 | |
Sequence |
|
>C. ELEGANS:192934_S_AT
ttccagctcttcaagatgaccgcacaatccgtaaaattcatatgatcgacgaccatgtga
tgctcgcttttgctggattgtccgcagatgctcgtgttcttgttgatcgtgctcgtatcg
agtgccagtcgtacaagttgactcttgaagatccagttaccgttgcctatatctccagat
atattgcaaacacgaagcagcgcttcacacaatctccaggacgtcgcccattcggaattt
caatgctcattggaggattcgatcatgacggaactccacgtcttttcaaaaccgagccat
ctggagcttactacgagtacgttgccaacgcgactggaagaggagagaaaccagtgcgtg
aataccttgaggagcaatacagcgaggaaaatactgtcgacgaagctaccactcttaaat
tggttgtaaagtcgctggctcaggtcgtaccaccaggatcacaaaatatcgagattgcag
tcatgaaaaaagttaatgatgagctgcagcaacgtgtattgtcaactgaagaaatcgagg
ctctcctgaaggttgtt
BLASTn GenBank NR |
|
|
|
|
|
|
TTCCAGCTCTTCAAGATGACCGCAC |
295 |
693 |
164 |
Antisense |
GATCGACGACCATGTGATGCTCGCT |
649 |
417 |
207 |
Antisense |
TGATGCTCGCTTTTGCTGGATTGTC |
311 |
565 |
221 |
Antisense |
ATGCTCGTGTTCTTGTTGATCGTGC |
614 |
41 |
251 |
Antisense |
GCTCGTATCGAGTGCCAGTCGTACA |
622 |
299 |
274 |
Antisense |
GGATTCGATCATGACGGAACTCCAC |
242 |
509 |
418 |
Antisense |
CGTCTTTTCAAAACCGAGCCATCTG |
453 |
245 |
442 |
Antisense |
ATACTGTCGACGAAGCTACCACTCT |
298 |
23 |
554 |
Antisense |
GTAAAGTCGCTGGCTCAGGTCGTAC |
3 |
461 |
589 |
Antisense |
GGTCGTACCACCAGGATCACAAAAT |
636 |
501 |
606 |
Antisense |
AATCGAGGCTCTCCTGAAGGTTGTT |
281 |
167 |
696 |
Antisense | |
|
Affymetrix Proprietary Database | |