[Home] | [Total List]

[192923_s_at]

Description F01G12.5A /REP_DB=WormBase Gene ID /WP=CE04334 /GEN=let-2 /TR=Q19099 /GB=AAA96215.1 /SUBMIT=ST.LOUIS /CHR=X /FEA=Sanger Annotation /DEF=alpha-2 type IV collagen
Cluster 6grp_highest_10_10 > 40      6grp_high1_10_10 > 05      4grp_high_8_8 > 51      6grp_highest_nonorm > 03      6grp_total > 05      4grp_total > 60      6grp_highest_sub > De      6grp_cgc > 22      6grp_high1_sub > De      6grp_cgc_sub > De      6grp_rule_based > S1      4grp_rule_based > L1      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 4468
1 2 3 4 range
A 4604.5
(3)
P 		3810.5
(1.9)
P 		3188.2
(1.1)
P 		136.2
(-3)
A 		4468
B 4318
(3)
P 		4073.5
(2.6)
P 		3190.1
(1.4)
P 		182.7
(-3)
P 		4135
C 3603.3
(3)
P 		3482.6
(2.8)
P 		3325
(2.5)
P 		216.1
(-3)
P 		3387
avr 4175.3
(3) 		3788.9
(2.4) 		3234.4
(1.6) 		178.3
(-3) 		3997

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 4144
1 2 3 4 5 6 range
A 4784
(3)
P 		3136.8
(-0)
P 		1651.4
(-2.7)
P 		2066.1
(-2)
P 		2307.4
(-1.5)
P 		1511.3
(-3)
P 		3273
B 4340.5
(3)
P 		3336.4
(1.2)
P 		2292.4
(-0.7)
P 		2167.7
(-0.9)
P 		1506.9
(-2.1)
P 		986.8
(-3)
P 		3354
C 4841.4
(3)
P 		3050.7
(0.4)
P 		3407.6
(0.9)
P 		2097.8
(-1)
P 		2611
(-0.2)
P 		697.5
(-3)
P 		4144
avr 4655.3
(3) 		3174.6
(0.5) 		2450.5
(-0.7) 		2110.5
(-1.3) 		2141.8
(-1.2) 		1065.2
(-3) 		3590
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 1657
1 2 3 4 range
A 1676.5
(3)
P 		827.2
(-0.1)
P 		833.5
(-0.1)
P 		19.9
(-3)
A 		1657
B 1377
(3)
P 		1006.1
(1.3)
P 		739.2
(0.1)
P 		38.9
(-3)
P 		1338
C 1192.8
(3)
P 		1001.3
(2)
P 		1158.9
(2.8)
P 		36.4
(-3)
P 		1156
avr 1415.4
(3) 		944.9
(1) 		910.5
(0.8) 		31.7
(-3) 		1384

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 1561
1 2 3 4 5 6 range
A 881.9
(1.1)
P 		1115.6
(3)
P 		359.6
(-3)
P 		524
(-1.7)
P 		696.3
(-0.3)
P 		367.9
(-2.9)
P 		756
B 1510.3
(3)
P 		1110.6
(0.9)
P 		556.7
(-2)
P 		574.2
(-1.9)
P 		612.2
(-1.7)
P 		368
(-3)
P 		1142
C 1794.5
(3)
P 		930.8
(-0.3)
P 		867.3
(-0.6)
P 		421.9
(-2.3)
P 		844.9
(-0.6)
P 		233.5
(-3)
P 		1561
avr 1395.6
(3) 		1052.3
(1.1) 		594.5
(-1.5) 		506.7
(-2) 		717.8
(-0.8) 		323.1
(-3) 		1073
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 192923_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.17579
Sequence Type Exemplar sequence
Representative Public ID F01G12.5A NCBI
Target Description F01G12.5A /REP_DB=WormBase Gene ID /WP=CE04334 /GEN=let-2 /TR=Q19099 /GB=AAA96215.1 /SUBMIT=ST.LOUIS /CHR=X /FEA=Sanger Annotation /DEF=alpha-2 type IV collagen
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_078262(11), NM_078263(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_078262 NCBI Caenorhabditis elegans LEThal family member (let-2) (let-2) mRNA, complete cds. 11/11 None
NM_078263 NCBI Caenorhabditis elegans LEThal family member (let-2) (let-2) mRNA, complete cds. 11/11 None
SNAP00000041958 ENSEMBL cdna:SNAP chromosome:CEL140:X:16380936:16386156:-1 11/11 None
GENEFINDER00000041968 ENSEMBL cdna:GeneFinder chromosome:CEL140:X:16380936:16389241:-1 11/11 None
F01G12.5b.1 ENSEMBL cdna:known chromosome:CEL140:X:16380514:16389241:-1 gene:F01G12.5 11/11 None
F01G12.5b.2 ENSEMBL cdna:known chromosome:CEL140:X:16380528:16389241:-1 gene:F01G12.5 11/11 None
F01G12.5a ENSEMBL cdna:known chromosome:CEL140:X:16380936:16389241:-1 gene:F01G12.5 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrX:16380935-16389241(-) 100.0 100.0
Public Domain and Genome References
Ensembl F01G12.5
Functional Annotations
Protein Similarities
Method ID Description E-Value
blast AAA96215 Lethal protein 2, isoform b [Caenorhabditis elegans] ref|NP_510663.1| LEThal family member (let-2) [Caenorhabditis elegans] pir||T29351 collagen alpha 2(IV) chain precursor let-2 - Caenorhabditis elegans 0.0
blast AAA96216 Lethal protein 2, isoform a [Caenorhabditis elegans] ref|NP_510664.1| LEThal family member (let-2) [Caenorhabditis elegans] 0.0
blast AAA64312 alpha2(IV) collagen 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR001442 EMBL-EBI Type 4 procollagen, C-terminal repeat 3.6E-72
Pfam IPR001442 EMBL-EBI Type 4 procollagen, C-terminal repeat 1.5E-75
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 6.3E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 2.5E-10
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.2E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.2E-6
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.0E-8
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 4.0E-10
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.1E-5
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.0E-4
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 7.1E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.5E-13
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 0.0012
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.2E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 2.7E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.4E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.7E-14
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.9E-13
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.6E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 7.9E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 9.0E-5
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.8E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.8E-10
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.1E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.5E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 2.5E-5
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.4E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.8E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.1E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.3E-9
Pfam IPR001442 EMBL-EBI Type 4 procollagen, C-terminal repeat 3.6E-72
Pfam IPR001442 EMBL-EBI Type 4 procollagen, C-terminal repeat 1.5E-75
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.6E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.0E-8
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 4.0E-10
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.1E-5
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.0E-4
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 7.1E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.5E-13
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 0.0012
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.2E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 2.7E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.4E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.7E-14
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.9E-13
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.6E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 7.9E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 9.0E-5
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.8E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.8E-10
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.1E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.5E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 2.5E-5
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.4E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.8E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.1E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.3E-9
Pfam IPR001442 EMBL-EBI Type 4 procollagen, C-terminal repeat 3.6E-72
Pfam IPR001442 EMBL-EBI Type 4 procollagen, C-terminal repeat 1.5E-75
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.7E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.1E-5
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 4.0E-10
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.1E-5
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.0E-4
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 7.1E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.5E-13
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 0.0012
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.2E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 2.7E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.4E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.7E-14
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.9E-13
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.6E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 7.9E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 9.0E-5
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.8E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.8E-10
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.1E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.5E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 2.5E-5
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.4E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.8E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.1E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.3E-9
Pfam IPR001442 EMBL-EBI Type 4 procollagen, C-terminal repeat 3.6E-72
Pfam IPR001442 EMBL-EBI Type 4 procollagen, C-terminal repeat 1.5E-75
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 6.3E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 2.5E-10
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.2E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.6E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.0E-8
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 4.0E-10
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.1E-5
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.0E-4
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 7.1E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.5E-13
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 0.0012
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.2E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 2.7E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.4E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.7E-14
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.9E-13
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.6E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 7.9E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 9.0E-5
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.8E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.8E-10
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.1E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.5E-7
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 2.5E-5
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 3.4E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.8E-11
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 5.1E-9
Pfam IPR008160 EMBL-EBI Collagen triple helix repeat 1.3E-9
Sequence
Target Sequence 
>C. ELEGANS:192923_S_AT
atcccataaccaagacctcggacacgctggatcatgcctccaaagattctccaccatgcc
attcctgttctgcgacttcaacaacgtctgcaactacgcctccagaaacgacaagtctta
ctggctctcaacatctgaagctatcccaatgatgccagtcaacgagcgtgaaatcgagcc
atacatctcgcgctgcgctgtgtgcgaagccccagccaacacgatcgctgttcactccca
gaccatccaaattccaaactgcccagcaggatggagcagcttgtggatcggatactcgtt
cgccatgcacaccggagccggagccgagggaggtggtcaatcactctcctcaccaggatc
ctgcttggaagacttccgtgccactccattcatcgagtgcaacggtgcccgcggatcttg
ccactactttgccaacaagttctcattctggcttacc

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
ATCCCATAACCAAGACCTCGGACAC 643 35 4713 Antisense
GTTCTGCGACTTCAACAACGTCTGC 81 443 4779 Antisense
AAACGACAAGTCTTACTGGCTCTCA 657 125 4818 Antisense
AAATCGAGCCATACATCTCGCGCTG 623 117 4883 Antisense
CCAGCCAACACGATCGCTGTTCACT 366 273 4924 Antisense
TTGTGGATCGGATACTCGTTCGCCA 417 703 4993 Antisense
AGGGAGGTGGTCAATCACTCTCCTC 171 59 5039 Antisense
CTCCTCACCAGGATCCTGCTTGGAA 559 233 5058 Antisense
CGTGCCACTCCATTCATCGAGTGCA 2 247 5089 Antisense
ATCTTGCCACTACTTTGCCAACAAG 410 31 5127 Antisense
CAACAAGTTCTCATTCTGGCTTACC 563 189 5145 Antisense
Sequence Source Affymetrix Proprietary Database