|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
192879_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.17192
|
|
Exemplar sequence
|
|
ZK899.8E NCBI
|
|
ZK899.8E /REP_DB=WormBase Gene ID /WP=CE23474 /GEN=gap-2 /TR=Q9TVE1 /GB=CAA86037.1 /SUBMIT=HINXTON /CHR=X /FEA=Sanger Annotation /DEF=GTPase-activating protein
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_077193(11), NM_077194(11), NM_077195(11), NM_077196(11), NM_077197(11), NM_171753(11), NM_077198(11), NM_171754(11) |
|
|
|
|
|
NM_077193 NCBI |
Caenorhabditis elegans GTPase Activating Protein family member (gap-2) (gap-2) mRNA, complete cds. |
11/11 |
A |
NM_077194 NCBI |
Caenorhabditis elegans GTPase Activating Protein family member (gap-2) (gap-2) mRNA, complete cds. |
11/11 |
None |
NM_077195 NCBI |
Caenorhabditis elegans GTPase Activating Protein family member (gap-2) (gap-2) mRNA, complete cds. |
11/11 |
None |
NM_077196 NCBI |
Caenorhabditis elegans GTPase Activating Protein family member (gap-2) (gap-2) mRNA, complete cds. |
11/11 |
None |
NM_077197 NCBI |
Caenorhabditis elegans GTPase Activating Protein family member (gap-2) (gap-2) mRNA, complete cds. |
11/11 |
None |
NM_171753 NCBI |
Caenorhabditis elegans GTPase Activating Protein family member (gap-2) (gap-2) mRNA, complete cds. |
11/11 |
None |
NM_077198 NCBI |
Caenorhabditis elegans GTPase Activating Protein family member (gap-2) (gap-2) mRNA, complete cds. |
11/11 |
None |
NM_171754 NCBI |
Caenorhabditis elegans GTPase Activating Protein family member (gap-2) (gap-2) mRNA, complete cds. |
11/11 |
None |
GENEFINDER00000005693 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:X:9510470:9515821:1 |
11/11 |
None |
SNAP00000005685 ENSEMBL |
cdna:SNAP chromosome:CEL140:X:9512751:9515821:1 |
11/11 |
None |
ZK899.8a ENSEMBL |
cdna:known chromosome:CEL140:X:9472399:9516374:1 gene:ZK899.8 |
11/11 |
A |
ZK899.8b ENSEMBL |
cdna:known chromosome:CEL140:X:9475193:9515821:1 gene:ZK899.8 |
11/11 |
None |
ZK899.8c ENSEMBL |
cdna:known chromosome:CEL140:X:9478939:9516372:1 gene:ZK899.8 |
11/11 |
A |
ZK899.8d ENSEMBL |
cdna:known chromosome:CEL140:X:9480597:9515821:1 gene:ZK899.8 |
11/11 |
None |
ZK899.8e ENSEMBL |
cdna:known chromosome:CEL140:X:9487310:9515821:1 gene:ZK899.8 |
11/11 |
None |
ZK899.8h ENSEMBL |
cdna:known chromosome:CEL140:X:9495225:9515821:1 gene:ZK899.8 |
11/11 |
None |
ZK899.8f ENSEMBL |
cdna:known chromosome:CEL140:X:9501550:9515821:1 gene:ZK899.8 |
11/11 |
None |
ZK899.8g ENSEMBL |
cdna:known chromosome:CEL140:X:9512745:9515821:1 gene:ZK899.8 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrX:9487326-9515821(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
ZK899.8
|
Functional Annotations |
|
|
|
|
|
blast |
CAA86416 |
Hypothetical protein ZK899.8a [Caenorhabditis elegans] emb|CAA86034.1| Hypothetical protein ZK899.8a [Caenorhabditis elegans] emb|CAA85503.1| Hypothetical protein ZK899.8a [Caenorhabditis elegans] ref|NP_509594.3| GTPase Activating Protein family member (gap-2) [Caenorhabditis elegans] sp|Q8MLZ5|GAP2_CAEEL Ras GTPase-activating protein gap-2 (GTPase-activating protein 2) |
0.0 |
blast |
CAA86417 |
Hypothetical protein ZK899.8b [Caenorhabditis elegans] emb|CAA86035.1| Hypothetical protein ZK899.8b [Caenorhabditis elegans] ref|NP_509595.1| GTPase Activating Protein family member (gap-2) [Caenorhabditis elegans] |
0.0 |
blast |
CAA86419 |
Hypothetical protein ZK899.8e [Caenorhabditis elegans] emb|CAA86037.1| Hypothetical protein ZK899.8e [Caenorhabditis elegans] ref|NP_509598.1| GTPase Activating Protein family member (gap-2) [Caenorhabditis elegans] |
0.0 |
blast |
CAA86418 |
Hypothetical protein ZK899.8d [Caenorhabditis elegans] emb|CAA86036.1| Hypothetical protein ZK899.8d [Caenorhabditis elegans] ref|NP_509597.1| GTPase Activating Protein family member (gap-2) [Caenorhabditis elegans] |
0.0 |
blast |
CAA86415 |
Hypothetical protein ZK899.8c [Caenorhabditis elegans] emb|CAA86033.1| Hypothetical protein ZK899.8c [Caenorhabditis elegans] ref|NP_509596.1| GTPase Activating Protein family member (gap-2) [Caenorhabditis elegans] |
0.0 |
blast |
BAA24960.1 |
GAP-2-4 [Caenorhabditis elegans] |
0.0 | |
|
|
|
|
|
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
1.4E-7 |
Pfam |
IPR001936 EMBL-EBI |
Ras GTPase-activating protein |
6.9E-49 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
1.4E-7 |
Pfam |
IPR001936 EMBL-EBI |
Ras GTPase-activating protein |
6.9E-49 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
1.4E-7 |
Pfam |
IPR001936 EMBL-EBI |
Ras GTPase-activating protein |
6.9E-49 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
1.4E-7 |
Pfam |
IPR001936 EMBL-EBI |
Ras GTPase-activating protein |
6.9E-49 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
1.4E-7 |
Pfam |
IPR001936 EMBL-EBI |
Ras GTPase-activating protein |
6.9E-49 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
1.4E-7 |
Pfam |
IPR001936 EMBL-EBI |
Ras GTPase-activating protein |
6.9E-49 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
1.4E-7 |
Pfam |
IPR001936 EMBL-EBI |
Ras GTPase-activating protein |
6.9E-49 |
Pfam |
IPR001936 EMBL-EBI |
Ras GTPase-activating protein |
6.9E-49 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
1.4E-7 |
Pfam |
IPR001936 EMBL-EBI |
Ras GTPase-activating protein |
6.9E-49 | |
Sequence |
|
>C. ELEGANS:192879_S_AT
aatccttcgagatccagctactcaaactcttcgagttcatctccagttgaacgaatggcc
gctctatcaattgctaacccagtctttggaccaggcccatcatctggatatgctatacct
gcagagccaaaggaaatcgtataccaaaagcgagcaagcccaccaccatacgatcccgat
gtgcacaactatcattatcaaccgatgcaggtctacgctgttccaccagattgtcaggtg
tccccaagaacgcaggcaacaggcggtgtcaatgctcagaatcggttaagtctgccacgg
actaatccacgagcttcgaggaattcaacacttttgcgtccgagtgtcgtaaatgttccg
gatgactgggatagaacaagtgattactggagggaccgaggcgagaacaactaccggagt
caactggaaagccaagtggaaagtcaagctcgagaaattgaacgcttgatgagagagaac
attgagctgaagagtaaaatgatgtcttcaacaaaaactgtggattccaagcgatctgac
agtggtgctagtgaggattcctacgattctttgagttcactcgatcgtccatca
BLASTn GenBank NR |
|
|
|
|
|
|
AATCCTTCGAGATCCAGCTACTCAA |
340 |
167 |
2536 |
Antisense |
AAACTCTTCGAGTTCATCTCCAGTT |
625 |
127 |
2559 |
Antisense |
TGCTAACCCAGTCTTTGGACCAGGC |
526 |
577 |
2607 |
Antisense |
GGACCAGGCCCATCATCTGGATATG |
287 |
523 |
2623 |
Antisense |
TACGATCCCGATGTGCACAACTATC |
200 |
649 |
2704 |
Antisense |
CAACCGATGCAGGTCTACGCTGTTC |
30 |
187 |
2734 |
Antisense |
TACGCTGTTCCACCAGATTGTCAGG |
438 |
649 |
2749 |
Antisense |
CAGGCGGTGTCAATGCTCAGAATCG |
269 |
209 |
2795 |
Antisense |
GGAATTCAACACTTTTGCGTCCGAG |
222 |
533 |
2855 |
Antisense |
GGATTCCTACGATTCTTTGAGTTCA |
178 |
509 |
3090 |
Antisense |
TTTGAGTTCACTCGATCGTCCATCA |
297 |
667 |
3105 |
Antisense | |
|
Affymetrix Proprietary Database |