|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
192312_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.7206
|
|
Exemplar sequence
|
|
T21C12.1 NCBI
|
|
T21C12.1 /REP_DB=WormBase Gene ID /WP=CE02346 /CHR=3 /FEA=Sanger Annotation /DEF=gamma-aminobutyric-acid receptor (HINXTON) TR:Q22637 protein_id:CAA90318.1
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq,GenBank identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001027610(11), NM_001027614(11), NM_001027612(11), NM_001027613(11), NM_001027615(11), AF151643(11), AF151645(11) |
|
|
|
|
|
NM_001027610 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-49) (unc-49) mRNA, complete cds. |
11/11 |
None |
NM_001027614 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-49) (unc-49) mRNA, complete cds. |
11/11 |
None |
NM_001027612 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-49) (unc-49) mRNA, complete cds. |
11/11 |
None |
NM_001027613 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-49) (unc-49) mRNA, complete cds. |
11/11 |
None |
NM_001027615 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-49) (unc-49) mRNA, complete cds. |
11/11 |
None |
AF151643 NCBI |
Caenorhabditis elegans ionotropic GABA receptor subunit UNC-49B.3 (unc-49B) mRNA, complete cds. |
11/11 |
None |
AF151645 NCBI |
Caenorhabditis elegans ionotropic GABA receptor subunit UNC-49Cshort (unc-49C) mRNA, complete cds. |
11/11 |
None |
SNAP00000038799 ENSEMBL |
cdna:SNAP chromosome:CEL140:III:10530455:10533022:1 |
9/11 |
None |
GENEFINDER00000038811 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:III:10530455:10532432:1 |
11/11 |
None |
T21C12.1a ENSEMBL |
cdna:known chromosome:CEL140:III:10520681:10532577:1 gene:T21C12.1 |
11/11 |
A |
T21C12.1c.1 ENSEMBL |
cdna:known chromosome:CEL140:III:10520724:10532580:1 gene:T21C12.1 |
11/11 |
A |
T21C12.1d ENSEMBL |
cdna:known chromosome:CEL140:III:10520724:10532580:1 gene:T21C12.1 |
11/11 |
A |
T21C12.1e ENSEMBL |
cdna:known chromosome:CEL140:III:10520724:10532580:1 gene:T21C12.1 |
11/11 |
A |
T21C12.1f ENSEMBL |
cdna:known chromosome:CEL140:III:10520736:10532584:1 gene:T21C12.1 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
|
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIII:10520842-10532428(+) |
99.94 |
100.0 |
| |
Public Domain and Genome References |
|
T21C12.1
|
Functional Annotations |
|
|
|
|
|
blast |
CAA90318 |
Hypothetical protein T21C12.1a [Caenorhabditis elegans] ref|NP_001022781.1| UNCoordinated family member (unc-49) [Caenorhabditis elegans] |
0.0 |
blast |
CAC42346 |
Hypothetical protein T21C12.1b [Caenorhabditis elegans] ref|NP_001022782.1| UNCoordinated family member (unc-49) [Caenorhabditis elegans] gb|AAD42382.1| ionotropic GABA receptor subunit UNC-49A [Caenorhabditis elegans] |
0.0 |
blast |
CAC42349 |
Hypothetical protein T21C12.1e [Caenorhabditis elegans] ref|NP_001022785.1| UNCoordinated family member (unc-49) [Caenorhabditis elegans] gb|AAD42385.1| ionotropic GABA receptor subunit UNC-49B.3 [Caenorhabditis elegans] |
0.0 |
blast |
CAC42347 |
Hypothetical protein T21C12.1c [Caenorhabditis elegans] ref|NP_001022783.1| UNCoordinated family member (unc-49) [Caenorhabditis elegans] gb|AAD42383.1| ionotropic GABA receptor subunit UNC-49B.1 [Caenorhabditis elegans] |
0.0 |
blast |
CAC42348 |
Hypothetical protein T21C12.1d [Caenorhabditis elegans] ref|NP_001022784.1| UNCoordinated family member (unc-49) [Caenorhabditis elegans] gb|AAD42384.1| ionotropic GABA receptor subunit UNC-49B.2 [Caenorhabditis elegans] |
0.0 | |
|
|
|
|
|
Pfam |
IPR006029 EMBL-EBI |
Neurotransmitter-gated ion-channel transmembrane region |
6.6E-39 |
Pfam |
IPR006029 EMBL-EBI |
Neurotransmitter-gated ion-channel transmembrane region |
1.6E-35 |
Pfam |
IPR006029 EMBL-EBI |
Neurotransmitter-gated ion-channel transmembrane region |
1.3E-15 |
Pfam |
IPR006202 EMBL-EBI |
Neurotransmitter-gated ion-channel ligand binding domain |
2.7E-75 |
Pfam |
IPR006202 EMBL-EBI |
Neurotransmitter-gated ion-channel ligand binding domain |
0.021 |
Pfam |
IPR006029 EMBL-EBI |
Neurotransmitter-gated ion-channel transmembrane region |
1.6E-35 |
Pfam |
IPR006029 EMBL-EBI |
Neurotransmitter-gated ion-channel transmembrane region |
1.0E-8 |
Pfam |
IPR006202 EMBL-EBI |
Neurotransmitter-gated ion-channel ligand binding domain |
3.1E-78 |
Pfam |
IPR006029 EMBL-EBI |
Neurotransmitter-gated ion-channel transmembrane region |
1.0E-8 |
Pfam |
IPR006029 EMBL-EBI |
Neurotransmitter-gated ion-channel transmembrane region |
1.0E-8 |
Pfam |
IPR006029 EMBL-EBI |
Neurotransmitter-gated ion-channel transmembrane region |
1.3E-15 |
Pfam |
IPR006202 EMBL-EBI |
Neurotransmitter-gated ion-channel ligand binding domain |
1.7E-75 |
Pfam |
IPR006029 EMBL-EBI |
Neurotransmitter-gated ion-channel transmembrane region |
1.3E-15 |
NP_001022781.1 |
8 |
261-283,290-309,324-346,529-551,592-614,913-935,977-999,1061-1083 |
NP_001022785.1 |
4 |
255-277,284-303,318-340,468-485 |
NP_001022783.1 |
4 |
255-277,284-303,318-340,449-466 |
NP_001022784.1 |
4 |
255-277,284-303,318-340,437-454 |
NP_001022786.1 |
3 |
255-277,319-341,403-425 |
AAD42385.1 |
4 |
255-277,284-303,318-340,468-485 |
AAD42387.1 |
3 |
71-93,135-157,219-241 |
T21C12.1a |
8 |
261-283,290-309,324-346,529-551,592-614,913-935,977-999,1061-1083 |
T21C12.1c.1 |
4 |
255-277,284-303,318-340,449-466 |
T21C12.1d |
4 |
255-277,284-303,318-340,437-454 |
T21C12.1e |
4 |
255-277,284-303,318-340,468-485 |
T21C12.1f |
3 |
255-277,319-341,403-425 |
SNAP00000038799 |
2 |
71-93,135-157 |
GENEFINDER00000038811 |
3 |
71-93,135-157,219-241 | |
Sequence |
|
>C. ELEGANS:192312_S_AT
tttgatcgcgacagcggcttctactttcttcaaatatttttccctgccagcctcgtcgta
gttttatcatggatctcattctggatcaatcgtgactcggcgccttcgcgaaccctaatc
ggtacgatgacggtgctcactgagactcatcttatgaccggaaccaatcgacgtcttcca
ccagttgcctatgtaaaagccgttgatgtattcctcggtttctgctatcttctggttata
ctggcgttgatcgagtacgcctgtgttgcctactcaaaaaagaagaacgaggatcgtcgg
agaagagagaagaagacggagcataaacctgctccgccgacacctgatattcttcacgac
gtccgccttgccgaatgcacatgcaacgcggctccaacctcgatcatcgccgtcatcaag
cagtcgaatcgattctgtgtcagtcacagtcacattgacatcgtcagccgtgccgcgttt
cctcttgttttcatcttgttcaacactctcttctggctgattctactgtacaaatccaag
cgtctgccgtatatta
BLASTn GenBank NR |
|
|
|
|
|
|
TTTGATCGCGACAGCGGCTTCTACT |
495 |
667 |
2734 |
Antisense |
TGCCAGCCTCGTCGTAGTTTTATCA |
394 |
587 |
2778 |
Antisense |
GACGGTGCTCACTGAGACTCATCTT |
552 |
377 |
2862 |
Antisense |
ATGACCGGAACCAATCGACGTCTTC |
329 |
45 |
2887 |
Antisense |
TCTTCCACCAGTTGCCTATGTAAAA |
160 |
619 |
2907 |
Antisense |
TGATGTATTCCTCGGTTTCTGCTAT |
281 |
567 |
2937 |
Antisense |
GACACCTGATATTCTTCACGACGTC |
14 |
369 |
3072 |
Antisense |
ATCATCGCCGTCATCAAGCAGTCGA |
152 |
29 |
3136 |
Antisense |
GTCACATTGACATCGTCAGCCGTGC |
366 |
465 |
3182 |
Antisense |
CTCTTCTGGCTGATTCTACTGTACA |
624 |
229 |
3241 |
Antisense |
AAATCCAAGCGTCTGCCGTATATTA |
13 |
117 |
3265 |
Antisense | |
|
Affymetrix Proprietary Database | |