[Home] | [Total List]

[192028_at] clathrin coat assembly protein

Description F29G9.3 /REP_DB=WormBase Gene ID /WP=CE09797 /TR=O16369 /GB=AAB65902.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=clathrin coat assemble protein
Cluster 6grp_highest_10_10 > 37      6grp_high1_10_10 > 61      4grp_highest_8_8 > 06      4grp_high_8_8 > 22      6grp_highest_nonorm > 55      6grp_total > 60      4grp_total > 25      6grp_highest_sub > 03_04      6grp_cgc > 93      6grp_high1_sub > 04      6grp_cgc_sub > 03      6grp_total_sub > Hat      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 631
1 2 3 4 range
A 1139.5
(-3)
P 		1600.1
(3)
P 		1211.8
(-2.1)
P 		1531.2
(2.1)
P 		461
B 1186.1
(-3)
P 		1373.4
(-1.1)
P 		1408.6
(-0.7)
P 		1763.5
(3)
P 		577
C 1132.1
(-3)
P 		1383.9
(-0.5)
P 		1391.7
(-0.4)
P 		1742.3
(3)
P 		610
avr 1152.6
(-3) 		1452.5
(0.4) 		1337.4
(-0.9) 		1679
(3) 		526

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 703
1 2 3 4 5 6 range
A 1695.8
(1.1)
P 		1321.3
(-3)
P 		1873.2
(3)
P 		1779.8
(2)
P 		1413.9
(-2)
P 		1420.5
(-1.9)
P 		552
B 1587.6
(-1)
P 		1363.7
(-3)
P 		2023.9
(3)
P 		1717.8
(0.2)
P 		1527.1
(-1.5)
P 		1454.8
(-2.2)
P 		660
C 1487.4
(-1.7)
P 		1369.7
(-3)
P 		1640.1
(0.1)
P 		1899.6
(3)
P 		1471.9
(-1.8)
P 		1497.9
(-1.5)
P 		530
avr 1590.3
(-0.1) 		1351.6
(-3) 		1845.7
(3) 		1799.1
(2.4) 		1471
(-1.6) 		1457.7
(-1.7) 		494
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 261
1 2 3 4 range
A 414.9
(3)
P 		347.3
(0.9)
P 		316.8
(-0.1)
P 		224.1
(-3)
P 		191
B 378.2
(3)
P 		339.2
(-1.5)
P 		326.4
(-3)
P 		375.8
(2.7)
P 		52
C 374.7
(-0.5)
P 		397.9
(0.3)
P 		485.1
(3)
P 		293.8
(-3)
P 		191
avr 389.3
(3) 		361.5
(1.2) 		376.1
(2.1) 		297.9
(-3) 		91

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 308
1 2 3 4 5 6 range
A 312.6
(-3)
P 		469.9
(3)
P 		407.9
(0.6)
P 		451.4
(2.3)
P 		426.7
(1.4)
P 		345.9
(-1.7)
P 		157
B 552.4
(0.5)
P 		453.9
(-3)
P 		491.5
(-1.6)
P 		455
(-3)
P 		620.4
(3)
P 		542.5
(0.2)
P 		167
C 551.3
(3)
P 		417.9
(-1.7)
P 		417.4
(-1.7)
P 		382
(-3)
P 		476.3
(0.3)
P 		501.4
(1.2)
P 		169
avr 472.1
(0.3) 		447.2
(-1.6) 		438.9
(-2.3) 		429.5
(-3) 		507.8
(3) 		463.3
(-0.4) 		78
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 192028_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.12510
Sequence Type Exemplar sequence
Representative Public ID F29G9.3 NCBI
Target Description F29G9.3 /REP_DB=WormBase Gene ID /WP=CE09797 /TR=O16369 /GB=AAB65902.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=clathrin coat assemble protein
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_072158(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_072158 NCBI Caenorhabditis elegans AP-2 Small chain (clathrin associated complex) family member (aps-1) (aps-1) mRNA, complete cds. 11/11 None
SNAP00000000272 ENSEMBL cdna:SNAP chromosome:CEL140:V:6020569:6021344:1 11/11 None
GENEFINDER00000000284 ENSEMBL cdna:GeneFinder chromosome:CEL140:V:6020569:6021344:1 11/11 None
F29G9.3 ENSEMBL cdna:known chromosome:CEL140:V:6020564:6021467:1 gene:F29G9.3 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrV:6020568-6021344(+) 100.0 100.0
Public Domain and Genome References
Gene Title clathrin coat assembly protein
Gene Symbol aps-1
Ensembl F29G9.3
Entrez Gene 178989 Entrez gene
SwissProt O16369 EMBL-EBI
WormBase CE09797 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:264847_AT clathrin assembly protein AP19 at
ATGENOME1:19114_AT clathrin assembly protein AP19 at
ATGENOME1:17101_F_AT clathrin assembly protein AP19 at
CANINE:1589057_AT similar to Adapter-related protein complex 1 sigma 1B subunit (Sigma-adaptin 1B) (Adaptor protein complex AP-1 sigma-1B subunit) (Golgi adaptor HA1/AP1 adaptin sigma-1B subunit) (Clathrin assembly protein complex 1 sigma-1B small chain) (Sigma 1B s... cfa
CANINE_2:CFA.20585.1.A1_AT similar to Adapter-related protein complex 1 sigma 1B subunit (Sigma-adaptin 1B) (Adaptor protein complex AP-1 sigma-1B subunit) (Golgi adaptor HA1/AP1 adaptin sigma-1B subunit) (Clathrin assembly protein complex 1 sigma-1B small chain) (Sigma 1B s... cfa
CANINE_2:CFAAFFX.18992.1.S1_S_AT similar to Adapter-related protein complex 1 sigma 1B subunit (Sigma-adaptin 1B) (Adaptor protein complex AP-1 sigma-1B subunit) (Golgi adaptor HA1/AP1 adaptin sigma-1B subunit) (Clathrin assembly protein complex 1 sigma-1B small chain) (Sigma 1B s... cfa
DROSOPHILA_2:1625876_AT dm
DROSGENOME1:153802_AT dm
CHICKEN:GGA.2564.1.S1_AT adaptor-related protein complex 1, sigma 2 subunit gga
CHICKEN:GGA.2564.1.S1_S_AT adaptor-related protein complex 1, sigma 2 subunit gga
HG-U95AV2:41549_S_AT adaptor-related protein complex 1, sigma 2 subunit hs
HG-U133_PLUS_2:230264_S_AT adaptor-related protein complex 1, sigma 2 subunit hs
HG-U133B:230264_S_AT adaptor-related protein complex 1, sigma 2 subunit hs
HG-U133_PLUS_2:203299_S_AT adaptor-related protein complex 1, sigma 2 subunit hs
HG-U133A:203299_S_AT adaptor-related protein complex 1, sigma 2 subunit hs
HG-FOCUS:203299_S_AT adaptor-related protein complex 1, sigma 2 subunit hs
HG-U133A_2:203299_S_AT adaptor-related protein complex 1, sigma 2 subunit hs
HU35KSUBA:D31120_AT adaptor-related protein complex 1, sigma 2 subunit hs
HU35KSUBC:RC_D80296_F_AT adaptor-related protein complex 1, sigma 2 subunit hs
HU35KSUBD:RC_AA233800_AT adaptor-related protein complex 1, sigma 2 subunit hs
HG-U133A:203300_X_AT adaptor-related protein complex 1, sigma 2 subunit hs
HG-U133_PLUS_2:203300_X_AT adaptor-related protein complex 1, sigma 2 subunit hs
HG-U133A_2:203300_X_AT adaptor-related protein complex 1, sigma 2 subunit hs
U133_X3P:G4506956_3P_A_AT adaptor-related protein complex 1, sigma 2 subunit hs
U133_X3P:G12005731_3P_AT adaptor-related protein complex 1, sigma 2 subunit hs
U133_X3P:HS.40368.3.S1_3P_A_AT adaptor-related protein complex 1, sigma 2 subunit hs
HG-U95B:56267_AT adaptor-related protein complex 1, sigma 2 subunit hs
HG-U133_PLUS_2:228415_AT Adaptor-related protein complex 1, sigma 2 subunit hs
HG-U133B:228415_AT Adaptor-related protein complex 1, sigma 2 subunit hs
HG-U133_PLUS_2:230413_S_AT Adaptor-related protein complex 1, sigma 2 subunit hs
HG-U133B:230413_S_AT Adaptor-related protein complex 1, sigma 2 subunit hs
HG-U133_PLUS_2:243745_AT Adaptor-related protein complex 1, sigma 2 subunit hs
HG-U133B:243745_AT Adaptor-related protein complex 1, sigma 2 subunit hs
HG-U95C:55526_AT Adaptor-related protein complex 1, sigma 2 subunit hs
HG-U95D:76372_AT Adaptor-related protein complex 1, sigma 2 subunit hs
HG-U95D:88312_AT Adaptor-related protein complex 1, sigma 2 subunit hs
HU35KSUBD:RC_AA449832_AT Adaptor-related protein complex 1, sigma 2 subunit hs
HU35KSUBD:RC_AA192173_AT Adaptor-related protein complex 1, sigma 2 subunit hs
HU35KSUBB:RC_R09487_AT Adaptor-related protein complex 1, sigma 2 subunit hs
U133_X3P:HS.121592.1.A1_3P_AT Adaptor-related protein complex 1, sigma 2 subunit hs
U133_X3P:HS.40368.2.A1_3P_AT Adaptor-related protein complex 1, sigma 2 subunit hs
U133_X3P:HS.40368.3.A1_3P_A_AT Adaptor-related protein complex 1, sigma 2 subunit hs
MOE430A:1456252_X_AT adaptor-related protein complex 1, sigma 2 subunit mm
MOUSE430A_2:1456252_X_AT adaptor-related protein complex 1, sigma 2 subunit mm
MOUSE430_2:1456252_X_AT adaptor-related protein complex 1, sigma 2 subunit mm
MG-U74BV2:106017_AT adaptor-related protein complex 1, sigma 2 subunit mm
MOE430A:1452657_AT adaptor-related protein complex 1, sigma 2 subunit mm
MOUSE430A_2:1452657_AT adaptor-related protein complex 1, sigma 2 subunit mm
MOUSE430_2:1452657_AT adaptor-related protein complex 1, sigma 2 subunit mm
MOE430B:1460036_AT adaptor-related protein complex 1, sigma 2 subunit mm
MOUSE430_2:1460036_AT adaptor-related protein complex 1, sigma 2 subunit mm
MOE430B:1447903_X_AT adaptor-related protein complex 1, sigma 2 subunit mm
MOUSE430_2:1447903_X_AT adaptor-related protein complex 1, sigma 2 subunit mm
MOUSE430A_2:1437998_AT Adaptor-related protein complex 1, sigma 2 subunit, mRNA (cDNA clone MGC:54976 IMAGE:6485320) mm
MOE430A:1437998_AT Adaptor-related protein complex 1, sigma 2 subunit, mRNA (cDNA clone MGC:54976 IMAGE:6485320) mm
MOUSE430_2:1437998_AT Adaptor-related protein complex 1, sigma 2 subunit, mRNA (cDNA clone MGC:54976 IMAGE:6485320) mm
MG-U74AV2:99344_AT Adaptor-related protein complex 1, sigma 2 subunit, mRNA (cDNA clone MGC:54976 IMAGE:6485320) mm
MU11KSUBA:D18859_RC_AT Adaptor-related protein complex 1, sigma 2 subunit, mRNA (cDNA clone MGC:54976 IMAGE:6485320) mm
RG-U34B:RC_AA946417_AT similar to Adapter-related protein complex 1 sigma 1B subunit (Sigma-adaptin 1B) (Adaptor protein complex AP-1 sigma-1B subunit) (Golgi adaptor HA1/AP1 adaptin sigma-1B subunit) (Clathrin assembly protein complex 1 sigma-1B small chain) (Sigma 1B s... rn
RAE230B:1398616_AT similar to Adapter-related protein complex 1 sigma 1B subunit (Sigma-adaptin 1B) (Adaptor protein complex AP-1 sigma-1B subunit) (Golgi adaptor HA1/AP1 adaptin sigma-1B subunit) (Clathrin assembly protein complex 1 sigma-1B small chain) (Sigma 1B s... rn
RAT230_2:1398616_AT similar to Adapter-related protein complex 1 sigma 1B subunit (Sigma-adaptin 1B) (Adaptor protein complex AP-1 sigma-1B subunit) (Golgi adaptor HA1/AP1 adaptin sigma-1B subunit) (Clathrin assembly protein complex 1 sigma-1B small chain) (Sigma 1B s... rn
RAE230B:1384187_AT similar to Adapter-related protein complex 1 sigma 1B subunit (Sigma-adaptin 1B) (Adaptor protein complex AP-1 sigma-1B subunit) (Golgi adaptor HA1/AP1 adaptin sigma-1B subunit) (Clathrin assembly protein complex 1 sigma-1B small chain) (Sigma 1B s... rn
RAT230_2:1384187_AT similar to Adapter-related protein complex 1 sigma 1B subunit (Sigma-adaptin 1B) (Adaptor protein complex AP-1 sigma-1B subunit) (Golgi adaptor HA1/AP1 adaptin sigma-1B subunit) (Clathrin assembly protein complex 1 sigma-1B small chain) (Sigma 1B s... rn
RAE230B:1396217_AT Similar to Adapter-related protein complex 1 sigma 1B subunit (Sigma-adaptin 1B) (Adaptor protein complex AP-1 sigma-1B subunit) (Golgi adaptor HA1/AP1 adaptin sigma-1B subunit) (Clathrin assembly protein complex 1 sigma-1B small chain) (Sigma 1B s... rn
RAT230_2:1396217_AT Similar to Adapter-related protein complex 1 sigma 1B subunit (Sigma-adaptin 1B) (Adaptor protein complex AP-1 sigma-1B subunit) (Golgi adaptor HA1/AP1 adaptin sigma-1B subunit) (Clathrin assembly protein complex 1 sigma-1B small chain) (Sigma 1B s... rn
RAE230B:1397857_AT Similar to Adapter-related protein complex 1 sigma 1B subunit (Sigma-adaptin 1B) (Adaptor protein complex AP-1 sigma-1B subunit) (Golgi adaptor HA1/AP1 adaptin sigma-1B subunit) (Clathrin assembly protein complex 1 sigma-1B small chain) (Sigma 1B s... rn
RAT230_2:1397857_AT Similar to Adapter-related protein complex 1 sigma 1B subunit (Sigma-adaptin 1B) (Adaptor protein complex AP-1 sigma-1B subunit) (Golgi adaptor HA1/AP1 adaptin sigma-1B subunit) (Clathrin assembly protein complex 1 sigma-1B small chain) (Sigma 1B s... rn
YEAST_2:1776372_AT Small subunit of the clathrin-associated adaptor complex AP-1, which is involved in protein sorting at the trans-Golgi network; homolog of the sigma subunit of the mammalian clathrin AP-1 complex Sc
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6886 intracellular protein transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
30125 clathrin vesicle coat inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAB65902 Adaptin, small chain (clathrin associated complex) protein 1 [Caenorhabditis elegans] ref|NP_504559.1| AP-2 Small chain (clathrin associated complex) family member (aps-1) [Caenorhabditis elegans] emb|CAE64527.1| Hypothetical protein CBG09266 [Caenorhabditis briggsae] 1.0E-86
blast AAF56212 CG5864-PA [Drosophila melanogaster] ref|NP_651198.1| CG5864-PA [Drosophila melanogaster] gb|AAL28720.1| LD14109p [Drosophila melanogaster] 7.0E-76
blast EAL27931 GA19188-PA [Drosophila pseudoobscura] 3.0E-75
Protein Domains
Database ID Description E-Value
Pfam IPR000804 EMBL-EBI Clathrin adaptor complex, small chain 6.7E-86
Sequence
Target Sequence 
>C. ELEGANS:192028_AT
ttctcttcagtcgccagggcaaactgcggctgcagaaatggtacactgcttaccccgaca
agcaaaagaagaaaatttgccgcgaactcatcactcaaattctggcgagaaaaccgaaaa
tgtgtgcgttcctcgaatacaaggatttgaaagttgtctacaaacgatacgcgtctctgt
atttctgctgcgccatcgaacaaaacgacaacgagctcatcactttggaagtcattcatc
gttacgtagaactcctcgacaaatattttggaagtgtttgtgagctggatatcatcttca
acttcgaaaaagcttacttcatactcgacgaatttttactggctggtgaaatccaggaaa
ccagtaaaaaacaagttttgaaggcgattgctgcccaagatctcattcaaga

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
TTCTCTTCAGTCGCCAGGGCAAACT 148 693 29 Antisense
AGAAATGGTACACTGCTTACCCCGA 597 69 62 Antisense
AAAATTTGCCGCGAACTCATCACTC 355 133 100 Antisense
AAATGTGTGCGTTCCTCGAATACAA 117 121 146 Antisense
ACGATACGCGTCTCTGTATTTCTGC 71 95 192 Antisense
TTTCTGCTGCGCCATCGAACAAAAC 223 671 210 Antisense
ACGACAACGAGCTCATCACTTTGGA 621 91 233 Antisense
GTTACGTAGAACTCCTCGACAAATA 623 443 269 Antisense
GAGCTGGATATCATCTTCAACTTCG 381 387 310 Antisense
TACTCGACGAATTTTTACTGGCTGG 593 641 350 Antisense
TTGCTGCCCAAGATCTCATTCAAGA 290 703 416 Antisense
Sequence Source Affymetrix Proprietary Database