|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
191978_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.18166
|
|
Exemplar sequence
|
|
F02G3.1 NCBI
|
|
F02G3.1 /REP_DB=WormBase Gene ID /WP=CE27122 /TR=Q19128 /GB=AAK39221.1 /SUBMIT=ST.LOUIS /CHR=X /FEA=Sanger Annotation /DEF=neural cell adhesion molecule
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_171616(11), NM_171615(11), NM_171617(11) |
|
|
|
|
|
NM_171616 NCBI |
Caenorhabditis elegans NCAM (neural cell adhesion molecule) homolog family member (ncam-1) (ncam-1) mRNA, complete cds. |
11/11 |
None |
NM_171615 NCBI |
Caenorhabditis elegans NCAM (neural cell adhesion molecule) homolog family member (ncam-1) (ncam-1) mRNA, complete cds. |
11/11 |
None |
NM_171617 NCBI |
Caenorhabditis elegans NCAM (neural cell adhesion molecule) homolog family member (ncam-1) (ncam-1) mRNA, complete cds. |
11/11 |
None |
GENEFINDER00000002295 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:X:699713:702726:1 |
11/11 |
None |
SNAP00000002286 ENSEMBL |
cdna:SNAP chromosome:CEL140:X:699723:702537:1 |
11/11 |
None |
F02G3.1b ENSEMBL |
cdna:known chromosome:CEL140:X:692977:703024:1 gene:F02G3.1 |
11/11 |
None |
F02G3.1a ENSEMBL |
cdna:known chromosome:CEL140:X:693004:703038:1 gene:F02G3.1 |
11/11 |
None |
F02G3.1c ENSEMBL |
cdna:known chromosome:CEL140:X:695066:702537:1 gene:F02G3.1 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrX:695066-702537(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
F02G3.1
|
Functional Annotations |
|
|
|
|
|
blast |
AAM54203 |
Hypothetical protein F02G3.1b [Caenorhabditis elegans] ref|NP_741708.1| NCAM (neural cell adhesion molecule) homolog family member (ncam-1) [Caenorhabditis elegans] |
0.0 |
blast |
AAM54202 |
Hypothetical protein F02G3.1a [Caenorhabditis elegans] ref|NP_741707.3| NCAM (neural cell adhesion molecule) homolog family member (ncam-1) [Caenorhabditis elegans] gb|AAL60231.1| immunoglobulin domain-containing protein F02G3.1 [Caenorhabditis elegans] |
0.0 |
blast |
AAM54204 |
Hypothetical protein F02G3.1c [Caenorhabditis elegans] ref|NP_741709.1| NCAM (neural cell adhesion molecule) homolog family member (ncam-1) [Caenorhabditis elegans] |
0.0 |
blast |
T29583 |
hypothetical protein F02G3.1 - Caenorhabditis elegans |
0.0 | |
|
|
|
|
|
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.4E-5 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.5E-4 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
1.4E-6 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
8.8E-6 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
9.1E-8 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
7.7E-5 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
1.5E-9 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.4E-5 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.5E-4 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
1.4E-6 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
8.8E-6 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
9.1E-8 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
7.7E-5 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
1.5E-9 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.4E-5 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.5E-4 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
1.9E-4 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
1.5E-9 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.4E-5 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.5E-4 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
7.7E-5 |
Pfam |
IPR007110 EMBL-EBI |
Immunoglobulin-like |
1.5E-9 |
NP_741708.1 |
2 |
5-24,861-883 |
NP_741707.3 |
2 |
5-24,861-883 |
NP_741709.1 |
2 |
32-51,888-910 |
F02G3.1b |
2 |
5-24,861-883 |
F02G3.1a |
2 |
5-24,861-883 |
F02G3.1c |
2 |
32-51,888-910 |
GENEFINDER00000002295 |
1 |
583-605 |
SNAP00000002286 |
1 |
557-579 | |
Sequence |
|
>C. ELEGANS:191978_AT
gtgaggagcaggagacaacccttgctcatgaagactctgctgaaattctaccaaccgatc
caagcacttcagtggagagagatgagatggttccatacggaagccttcttgttctaaatg
tggattccgaggaaaatcaagtgcagctgacaaatatcaagcagcactcttattacaaaa
tcagtgttgctgccgaaaatgaaaagggtcaaggagaaccagcggagatagacttccaaa
ctgatgattccccaacaaaatacgaggaaggaattgattctactcacttgattattgcaa
ttgcaattggagtacttttcttactacttctagtggatctagggtgctttatcacaaata
aatgtgggcttatttcttgcatatgttt
BLASTn GenBank NR |
|
|
|
|
|
|
GTGAGGAGCAGGAGACAACCCTTGC |
301 |
457 |
2453 |
Antisense |
CAACCCTTGCTCATGAAGACTCTGC |
284 |
187 |
2468 |
Antisense |
TGAAATTCTACCAACCGATCCAAGC |
82 |
573 |
2493 |
Antisense |
CCAACCGATCCAAGCACTTCAGTGG |
153 |
277 |
2503 |
Antisense |
GATGGTTCCATACGGAAGCCTTCTT |
669 |
407 |
2538 |
Antisense |
AAGCCTTCTTGTTCTAAATGTGGAT |
343 |
149 |
2553 |
Antisense |
ATATCAAGCAGCACTCTTATTACAA |
133 |
21 |
2606 |
Antisense |
GACTTCCAAACTGATGATTCCCCAA |
13 |
371 |
2683 |
Antisense |
GGAGTACTTTTCTTACTACTTCTAG |
350 |
513 |
2761 |
Antisense |
GTGGATCTAGGGTGCTTTATCACAA |
10 |
491 |
2785 |
Antisense |
GTGGGCTTATTTCTTGCATATGTTT |
319 |
489 |
2816 |
Antisense | |
|
Affymetrix Proprietary Database |