[Home] | [Total List]

[191893_s_at] RNA polymerase II

Description F36A4.7 /REP_DB=WormBase Gene ID /WP=CE28300 /GEN=ama-1 /TR=Q20090 /GB=AAA96158.2 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation /DEF=RNA polymerase II
Cluster 4grp_high_8_8 > 35      6grp_total > 25      4grp_total > 53      6grp_cgc > 24      6grp_cgc_sub > Cu      6grp_total_sub > Decrease      6grp_rule_based > S1      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 375
1 2 3 4 range
A 631.6
(-0.1)
P 		636
(0)
P 		800.7
(3)
P 		470.7
(-3)
P 		330
B 685.1
(2.4)
P 		573.6
(0.1)
P 		425.7
(-3)
P 		711.5
(3)
P 		286
C 614.5
(1.2)
P 		674.7
(3)
P 		555.8
(-0.6)
P 		474
(-3)
A 		201
avr 643.7
(3) 		628.1
(2) 		594.1
(-0.2) 		552.1
(-3) 		92

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 726
1 2 3 4 5 6 range
A 864
(3)
P 		616.6
(-0.3)
P 		496.4
(-2)
A 		538.6
(-1.4)
A 		420.2
(-3)
A 		427
(-2.9)
P 		444
B 574.7
(0.4)
P 		818.7
(3)
P 		624.8
(1)
A 		486.1
(-0.5)
P 		247
(-3)
A 		428.3
(-1.1)
P 		572
C 958.8
(3)
P 		677.8
(0.7)
P 		420.8
(-1.4)
M 		316.4
(-2.3)
A 		233.1
(-3)
P 		272.9
(-2.7)
A 		726
avr 799.2
(3) 		704.4
(1.9) 		514
(-0.4) 		447
(-1.2) 		300.1
(-3) 		376.1
(-2.1) 		499
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 161
1 2 3 4 range
A 230
(3)
P 		138.1
(-0.4)
P 		209.3
(2.2)
P 		68.9
(-3)
P 		161
B 218.5
(3)
P 		141.7
(-0.8)
P 		98.7
(-3)
P 		151.6
(-0.4)
P 		120
C 203.4
(3)
P 		194
(2.5)
P 		193.7
(2.5)
P 		79.9
(-3)
A 		124
avr 217.3
(3) 		157.9
(-0) 		167.2
(0.4) 		100.1
(-3) 		117

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 292
1 2 3 4 5 6 range
A 159.3
(-0.1)
P 		219.3
(3)
P 		108.1
(-2.8)
A 		136.6
(-1.3)
A 		126.8
(-1.8)
A 		104
(-3)
P 		115
B 200
(0.5)
P 		272.5
(3)
P 		151.7
(-1.2)
A 		128.7
(-2)
P 		100.3
(-3)
A 		159.7
(-0.9)
P 		172
C 355.4
(3)
P 		206.8
(-0.1)
P 		107.1
(-2.1)
M 		63.6
(-3)
A 		75.4
(-2.8)
P 		91.3
(-2.4)
A 		292
avr 238.2
(3) 		232.9
(2.8) 		122.3
(-2.1) 		109.6
(-2.6) 		100.8
(-3) 		118.3
(-2.2) 		137
NetAffx Links Cluster Members
Consensus/Exemplar
Group Members
GeneChip Array Information
Probe Set ID 191893_s_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.10802
Sequence Type Exemplar sequence
Representative Public ID F36A4.7 NCBI
Target Description F36A4.7 /REP_DB=WormBase Gene ID /WP=CE28300 /GEN=ama-1 /TR=Q20090 /GB=AAA96158.2 /SUBMIT=ST.LOUIS /CHR=4 /FEA=Sanger Annotation /DEF=RNA polymerase II
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_068122(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_068122 NCBI Caenorhabditis elegans AMAnitin resistant family member (ama-1) (ama-1) mRNA, complete cds. 11/11 None
SNAP00000033259 ENSEMBL cdna:SNAP chromosome:CEL140:IV:4248181:4257775:1 11/11 None
GENEFINDER00000033282 ENSEMBL cdna:GeneFinder chromosome:CEL140:IV:4248181:4258392:1 11/11 None
F36A4.7 ENSEMBL cdna:known chromosome:CEL140:IV:4248181:4258150:1 gene:F36A4.7 11/11 None
Annotation Notes
There are no noteworthy cross hybridizing mRNAs found for this probe set.
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrIV:4248186-4257781(+) 100.0 100.0
Public Domain and Genome References
Gene Title RNA polymerase II
Gene Symbol ama-1
Ensembl F36A4.7
Entrez Gene 177190 Entrez gene
SwissProt P16356 EMBL-EBI
WormBase CE28300 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATGENOME1:12245_S_AT DNA-directed RNA polymerase II largest subunit (RPB205) (RPII) (RPB1) at
ATH1-121501:253133_AT DNA-directed RNA polymerase II largest subunit (RPB205) (RPII) (RPB1) at
CANINE:1601870_AT similar to DNA-directed RNA polymerase II largest subunit (RPB1) cfa
CANINE:1586728_AT similar to DNA-directed RNA polymerase II largest subunit (RPB1) cfa
CANINE_2:CFA.1419.1.A1_AT similar to DNA-directed RNA polymerase II largest subunit (RPB1) cfa
CANINE_2:CFA.7393.1.A1_S_AT similar to DNA-directed RNA polymerase II largest subunit (RPB1) cfa
CANINE_2:CFAAFFX.25354.1.S1_S_AT similar to DNA-directed RNA polymerase II largest subunit (RPB1) cfa
DROSOPHILA_2:1640764_AT RNA polymerase II 215kD subunit dm
DROSGENOME1:155027_AT RNA polymerase II 215kD subunit dm
HG-U133_PLUS_2:202725_AT polymerase (RNA) II (DNA directed) polypeptide A, 220kDa hs
HG-U133A:202725_AT polymerase (RNA) II (DNA directed) polypeptide A, 220kDa hs
HG-FOCUS:202725_AT polymerase (RNA) II (DNA directed) polypeptide A, 220kDa hs
HG-U133A_2:202725_AT polymerase (RNA) II (DNA directed) polypeptide A, 220kDa hs
HG-U95AV2:40791_AT polymerase (RNA) II (DNA directed) polypeptide A, 220kDa hs
HU35KSUBB:RC_AA010216_AT polymerase (RNA) II (DNA directed) polypeptide A, 220kDa hs
HUGENEFL:X74874_RNA1_S_AT polymerase (RNA) II (DNA directed) polypeptide A, 220kDa hs
U133_X3P:G4505938_3P_AT polymerase (RNA) II (DNA directed) polypeptide A, 220kDa hs
U133_X3P:HS.171880.1.A1_3P_A_AT polymerase (RNA) II (DNA directed) polypeptide A, 220kDa hs
HG-U133A_2:217420_S_AT polymerase (RNA) II (DNA directed) polypeptide A, 220kDa hs
HG-U133_PLUS_2:217420_S_AT polymerase (RNA) II (DNA directed) polypeptide A, 220kDa hs
HG-U133A:217420_S_AT polymerase (RNA) II (DNA directed) polypeptide A, 220kDa hs
HG-U133A_2:217415_AT polymerase (RNA) II (DNA directed) polypeptide A, 220kDa hs
HG-U133_PLUS_2:217415_AT polymerase (RNA) II (DNA directed) polypeptide A, 220kDa hs
HG-U133A:217415_AT polymerase (RNA) II (DNA directed) polypeptide A, 220kDa hs
HG-U95C:52769_AT Polymerase (RNA) II (DNA directed) polypeptide A, 220kDa hs
HG-U95C:57511_AT Polymerase (RNA) II (DNA directed) polypeptide A, 220kDa hs
MOUSE430A_2:1422311_A_AT polymerase (RNA) II (DNA directed) polypeptide A mm
MOUSE430_2:1422311_A_AT polymerase (RNA) II (DNA directed) polypeptide A mm
MOE430A:1422311_A_AT polymerase (RNA) II (DNA directed) polypeptide A mm
MOUSE430_2:1426242_AT polymerase (RNA) II (DNA directed) polypeptide A mm
MOE430A:1426242_AT polymerase (RNA) II (DNA directed) polypeptide A mm
MOUSE430A_2:1426242_AT polymerase (RNA) II (DNA directed) polypeptide A mm
MG-U74AV2:103055_R_AT polymerase (RNA) II (DNA directed) polypeptide A mm
MU11KSUBA:U37500_F_AT polymerase (RNA) II (DNA directed) polypeptide A mm
MG-U74AV2:103054_AT polymerase (RNA) II (DNA directed) polypeptide A mm
MU11KSUBB:MSA.1148.0_F_AT Polymerase (RNA) II (DNA directed) polypeptide A (Polr2a), mRNA mm
MOE430B:1458710_AT Polymerase (RNA) II (DNA directed) polypeptide A (Polr2a), mRNA mm
MOUSE430_2:1458710_AT Polymerase (RNA) II (DNA directed) polypeptide A (Polr2a), mRNA mm
RG-U34A:X59608EXON_AT polymerase (RNA) II (DNA directed) polypeptide A rn
RG-U34C:RC_AA819317_AT polymerase (RNA) II (DNA directed) polypeptide A rn
RG-U34C:RC_AI103719_AT polymerase (RNA) II (DNA directed) polypeptide A rn
RAE230A:1388808_AT polymerase (RNA) II (DNA directed) polypeptide A rn
RAT230_2:1388808_AT polymerase (RNA) II (DNA directed) polypeptide A rn
RAE230B:1382976_AT Polymerase (RNA) II (DNA directed) polypeptide A rn
RAT230_2:1382976_AT Polymerase (RNA) II (DNA directed) polypeptide A rn
RG-U34B:RC_AA964885_AT Polymerase (RNA) II (DNA directed) polypeptide A rn
YEAST_2:1775403_AT RNA polymerase II largest subunit B220, part of central core; phosphorylation of C-terminal heptapeptide repeat domain regulates association with transcription and splicing factors; similar to bacterial beta-prime Sc
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6350 transcription inferred from electronic annotation QuickGO AmiGO
6366 transcription from RNA polymerase II promoter inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
5634 nucleus inferred from electronic annotation QuickGO AmiGO
5665 DNA-directed RNA polymerase II, core complex inferred from electronic annotation QuickGO AmiGO
5634 nucleus inferred from direct assay QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
3677 DNA binding inferred from electronic annotation QuickGO AmiGO
3899 DNA-directed RNA polymerase activity inferred from electronic annotation QuickGO AmiGO
3899 DNA-directed RNA polymerase activity inferred from sequence similarity QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAA96158 Amanitin resistant protein 1 [Caenorhabditis elegans] ref|NP_500523.3| AMAnitin resistant family member (ama-1) [Caenorhabditis elegans] sp|P16356|RPB1_CAEEL DNA-directed RNA polymerase II largest subunit 0.0
blast T29959 DNA-directed RNA polymerase II large subunit ama-1 - Caenorhabditis elegans 0.0
blast AAA28126 RNA polymerase II 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR000722 EMBL-EBI RNA polymerase, alpha subunit 1.6E-106
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 40.0
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 1.6
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0010
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0060
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0046
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0019
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0019
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0092
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0098
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 5.0E-4
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 5.0E-4
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 11.0
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0064
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 7.6E-4
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0012
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.026
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.098
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.01
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 1.3
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0025
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.01
Pfam IPR007066 EMBL-EBI RNA polymerase Rpb1, domain 3 7.1E-78
Pfam IPR007083 EMBL-EBI RNA polymerase Rpb1, domain 4 2.2E-57
Pfam IPR007081 EMBL-EBI RNA polymerase Rpb1, domain 5 1.0E-126
Pfam IPR007075 EMBL-EBI RNA polymerase Rpb1, domain 6 9.6E-120
Pfam IPR007073 EMBL-EBI RNA polymerase Rpb1, domain 7 1.4E-94
Pfam IPR007080 EMBL-EBI RNA polymerase Rpb1, domain 1 1.0E-126
Pfam IPR000722 EMBL-EBI RNA polymerase, alpha subunit 3.8E-111
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 40.0
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 1.6
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0010
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0060
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0046
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0019
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0019
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0092
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0098
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 5.0E-4
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 5.0E-4
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 11.0
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0064
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 7.6E-4
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0012
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.026
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.098
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.01
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 1.3
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0025
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.01
Pfam IPR007066 EMBL-EBI RNA polymerase Rpb1, domain 3 7.1E-78
Pfam IPR007083 EMBL-EBI RNA polymerase Rpb1, domain 4 2.2E-57
Pfam IPR007081 EMBL-EBI RNA polymerase Rpb1, domain 5 1.0E-126
Pfam IPR007075 EMBL-EBI RNA polymerase Rpb1, domain 6 9.6E-120
Pfam IPR007073 EMBL-EBI RNA polymerase Rpb1, domain 7 1.4E-94
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 40.0
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 1.6
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0010
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0060
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0046
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0019
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0092
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0098
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 5.0E-4
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 11.0
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0064
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 7.6E-4
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.0012
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.026
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.098
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 0.01
Pfam IPR000684 EMBL-EBI Eukaryotic RNA polymerase II heptapeptide repeat 1.3
Pfam IPR007081 EMBL-EBI RNA polymerase Rpb1, domain 5 1.0E-126
Pfam IPR007075 EMBL-EBI RNA polymerase Rpb1, domain 6 2.0E-113
Pfam IPR007073 EMBL-EBI RNA polymerase Rpb1, domain 7 1.4E-94
Sequence
Target Sequence 
>C. ELEGANS:191893_S_AT
ccaacatcgccaagttattcgccgtcgtcgccaagctatagcccttcgtcgccgagctac
tcgccttcaagcccgagatattcgccaacgtcgccgacgtacagtccgacgagtccaacg
tactctccaacatctccaacgtactcgccgacgtcgccaacatattctccaacatctcca
agttatgaaagtggaggtggatacagcccatcgagccccaagtactcgccgtcgtcgcct
acctattcgcctacgtcgccgagctactcgccaacatcaccacagtactcgccgacgagt
ccgcagtacagtccgagctcgccgacgtacactccatcctcgccgacatacaatccaaca
tctccacgcggattctcgtcgccacagtactctccgacgtcgcctacctattcgcctacg
tcgcctagctacacgccgtcgtcgccgcagtactcgccgacgtcgcctacctacactcca
agtccatcggagcagccaggaacttcggctca

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
CCAACATCGCCAAGTTATTCGCCGT 484 275 4987 Antisense
ACTCGCCTTCAAGCCCGAGATATTC 513 99 5045 Antisense
TCAAGCCCGAGATATTCGCCAACGT 662 631 5053 Antisense
TATTCGCCAACGTCGCCGACGTACA 707 661 5065 Antisense
CGTCGCCGACGTACAGTCCGACGAG 208 245 5075 Antisense
TACAGTCCGACGAGTCCAACGTACT 514 641 5086 Antisense
AACATATTCTCCAACATCTCCAAGT 155 139 5145 Antisense
TTCTCCAACATCTCCAAGTTATGAA 455 693 5151 Antisense
TGGAGGTGGATACAGCCCATCGAGC 405 549 5178 Antisense
TCCAAGTCCATCGGAGCAGCCAGGA 609 587 5463 Antisense
CGGAGCAGCCAGGAACTTCGGCTCA 270 241 5474 Antisense
Sequence Source Affymetrix Proprietary Database