|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
191870_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.5343
|
|
Exemplar sequence
|
|
T13C2.4 NCBI
|
|
T13C2.4 /REP_DB=WormBase Gene ID /WP=CE04940 /TR=Q22453 /GB=AAA81134.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=LDL receptor-related protein
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_062986(11), NM_182223(11) |
|
|
|
|
|
NM_062986 NCBI |
Caenorhabditis elegans T13C2.6a (T13C2.6) mRNA, complete cds. |
11/11 |
A |
NM_182223 NCBI |
Caenorhabditis elegans T13C2.6b (T13C2.6) mRNA, complete cds. |
11/11 |
A |
SNAP00000037673 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:6783399:6787626:1 |
11/11 |
None |
GENEFINDER00000037680 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:6783399:6787626:1 |
11/11 |
None |
T13C2.6a.2 ENSEMBL |
cdna:known chromosome:CEL140:II:6783355:6788200:1 gene:T13C2.6 |
11/11 |
A |
T13C2.6a.1 ENSEMBL |
cdna:known chromosome:CEL140:II:6783357:6788200:1 gene:T13C2.6 |
11/11 |
A |
T13C2.6b ENSEMBL |
cdna:known chromosome:CEL140:II:6783357:6787626:1 gene:T13C2.6 |
11/11 |
A |
T13C2.6a.3 ENSEMBL |
cdna:known chromosome:CEL140:II:6783360:6788461:1 gene:T13C2.6 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:6776501-6787621(+) |
96.12 |
99.17 |
| |
Public Domain and Genome References |
|
T13C2.6
|
Functional Annotations |
|
|
|
|
|
blast |
AAS80338 |
Hypothetical protein T13C2.6a [Caenorhabditis elegans] ref|NP_495387.2| T13C2.6a [Caenorhabditis elegans] |
0.0 |
blast |
AAS80339 |
Hypothetical protein T13C2.6b [Caenorhabditis elegans] ref|NP_872023.2| T13C2.6b [Caenorhabditis elegans] |
0.0 |
blast |
T16860 |
hypothetical protein T13C2.4 - Caenorhabditis elegans |
0.0 | |
|
|
|
|
|
Pfam |
IPR006209 EMBL-EBI |
EGF-like domain |
5.8E-4 |
Pfam |
IPR002172 EMBL-EBI |
Low density lipoprotein-receptor, class A |
1.8E-16 |
Pfam |
IPR002172 EMBL-EBI |
Low density lipoprotein-receptor, class A |
2.4E-11 |
Pfam |
IPR002172 EMBL-EBI |
Low density lipoprotein-receptor, class A |
1.9E-12 |
Pfam |
IPR002172 EMBL-EBI |
Low density lipoprotein-receptor, class A |
2.7E-14 |
Pfam |
IPR002172 EMBL-EBI |
Low density lipoprotein-receptor, class A |
2.2E-16 |
Pfam |
IPR002172 EMBL-EBI |
Low density lipoprotein-receptor, class A |
2.5E-13 |
Pfam |
IPR002172 EMBL-EBI |
Low density lipoprotein-receptor, class A |
1.3E-4 |
Pfam |
IPR000033 EMBL-EBI |
Low-density lipoprotein receptor, YWTD repeat |
4.5E-12 |
Pfam |
IPR000033 EMBL-EBI |
Low-density lipoprotein receptor, YWTD repeat |
7.8E-15 |
Pfam |
IPR000033 EMBL-EBI |
Low-density lipoprotein receptor, YWTD repeat |
1.7E-5 |
Pfam |
IPR006209 EMBL-EBI |
EGF-like domain |
5.8E-4 |
Pfam |
IPR002172 EMBL-EBI |
Low density lipoprotein-receptor, class A |
1.2E-16 |
Pfam |
IPR002172 EMBL-EBI |
Low density lipoprotein-receptor, class A |
7.9E-11 |
Pfam |
IPR002172 EMBL-EBI |
Low density lipoprotein-receptor, class A |
1.9E-12 |
Pfam |
IPR002172 EMBL-EBI |
Low density lipoprotein-receptor, class A |
2.7E-14 |
Pfam |
IPR002172 EMBL-EBI |
Low density lipoprotein-receptor, class A |
2.2E-16 |
Pfam |
IPR002172 EMBL-EBI |
Low density lipoprotein-receptor, class A |
2.5E-13 |
Pfam |
IPR002172 EMBL-EBI |
Low density lipoprotein-receptor, class A |
1.3E-4 |
Pfam |
IPR000033 EMBL-EBI |
Low-density lipoprotein receptor, YWTD repeat |
4.5E-12 |
Pfam |
IPR000033 EMBL-EBI |
Low-density lipoprotein receptor, YWTD repeat |
7.8E-15 |
Pfam |
IPR000033 EMBL-EBI |
Low-density lipoprotein receptor, YWTD repeat |
1.7E-5 |
NP_495387.2 |
1 |
819-841 |
NP_872023.2 |
1 |
821-843 |
T13C2.6a.2 |
1 |
819-841 |
T13C2.6a.1 |
1 |
819-841 |
T13C2.6b |
1 |
821-843 |
T13C2.6a.3 |
1 |
819-841 |
SNAP00000037673 |
1 |
819-841 |
GENEFINDER00000037680 |
1 |
819-841 | |
Sequence |
|
>C. ELEGANS:191870_S_AT
aaatccggaatctcgatgttcacgattttccttcttttatgtgttggtggagttgtggcc
gctggatttgtgattgttcgtcggaagatgggacctcgtacatttaccgctctcaatttt
gacaatccaatttatcgtcgaaccaccgaagaagctgatcatcagatggaagatccattc
cgtgatccttttgctgaaccacggaa
BLASTn GenBank NR |
|
|
|
|
|
|
AAATCCGGAATCTCGATGTTCACGA |
623 |
115 |
3802 |
Antisense |
ATGTTCACGATTTTCCTTCTTTTAT |
316 |
47 |
3817 |
Antisense |
GATTTTCCTTCTTTTATGTGTTGGT |
463 |
429 |
3825 |
Antisense |
GGCCGCTGGATTTGTGATTGTTCGT |
279 |
543 |
3858 |
Antisense |
GAAGATGGGACCTCGTACATTTACC |
623 |
283 |
3885 |
Antisense |
GTACATTTACCGCTCTCAATTTTGA |
388 |
459 |
3899 |
Antisense |
ACCGCTCTCAATTTTGACAATCCAA |
305 |
89 |
3907 |
Antisense |
ACAATCCAATTTATCGTCGAACCAC |
384 |
113 |
3923 |
Antisense |
CGAACCACCGAAGAAGCTGATCATC |
69 |
253 |
3940 |
Antisense |
GGAAGATCCATTCCGTGATCCTTTT |
577 |
531 |
3969 |
Antisense |
GTGATCCTTTTGCTGAACCACGGAA |
521 |
483 |
3983 |
Antisense | |
|
Affymetrix Proprietary Database |