|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
191783_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.14584
|
|
Exemplar sequence
|
|
F53C11.3 NCBI
|
|
F53C11.3 /REP_DB=WormBase Gene ID /WP=CE10908 /TR=SW:Q93761 /GB=CAB02118.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=2,4-dienoyl-CoA reductase
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_074012(11) |
|
|
|
|
|
NM_074012 NCBI |
Caenorhabditis elegans F53C11.3 (F53C11.3) mRNA, complete cds. |
11/11 |
None |
SNAP00000007158 ENSEMBL |
cdna:SNAP chromosome:CEL140:V:13785078:13786623:1 |
11/11 |
None |
GENEFINDER00000007169 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:V:13785078:13786623:1 |
11/11 |
None |
F53C11.3 ENSEMBL |
cdna:known chromosome:CEL140:V:13784991:13786691:1 gene:F53C11.3 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrV:13785077-13786623(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
2,4-dienoyl-CoA reductase
|
|
F53C11.3
|
|
179872 Entrez gene
|
|
Q93761 EMBL-EBI
|
|
CE10908 Wormbase
|
Functional Annotations |
|
|
|
|
CANINE:1592274_AT |
similar to 2,4-dienoyl-CoA reductase, mitochondrial precursor (2,4-dienoyl-CoA reductase [NADPH]) (4-enoyl-CoA reductase [NADPH]) |
cfa |
CANINE:1584003_X_AT |
similar to 2,4-dienoyl-CoA reductase, mitochondrial precursor (2,4-dienoyl-CoA reductase [NADPH]) (4-enoyl-CoA reductase [NADPH]) |
cfa |
CANINE:1584002_S_AT |
similar to 2,4-dienoyl-CoA reductase, mitochondrial precursor (2,4-dienoyl-CoA reductase [NADPH]) (4-enoyl-CoA reductase [NADPH]) |
cfa |
CANINE:1584001_AT |
similar to 2,4-dienoyl-CoA reductase, mitochondrial precursor (2,4-dienoyl-CoA reductase [NADPH]) (4-enoyl-CoA reductase [NADPH]) |
cfa |
CANINE_2:CFA.6367.1.A1_AT |
similar to 2,4-dienoyl-CoA reductase, mitochondrial precursor (2,4-dienoyl-CoA reductase [NADPH]) (4-enoyl-CoA reductase [NADPH]) |
cfa |
CANINE_2:CFAAFFX.14220.1.S1_S_AT |
similar to 2,4-dienoyl-CoA reductase, mitochondrial precursor (2,4-dienoyl-CoA reductase [NADPH]) (4-enoyl-CoA reductase [NADPH]) |
cfa |
CHICKEN:GGA.9634.1.S1_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
gga |
HG-U133A:202447_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
hs |
HG-U133_PLUS_2:202447_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
hs |
HG-U133A_2:202447_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
hs |
HG-FOCUS:202447_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
hs |
HUGENEFL:U49352_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
hs |
U133_X3P:G4503300_3P_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
hs |
HG-U95AV2:38104_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
hs |
HG-U133_PLUS_2:236432_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
hs |
HG-U133B:236432_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
hs |
HG-U133_PLUS_2:240510_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
hs |
HG-U133B:240510_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
hs |
HG-U95C:64647_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
hs |
HG-U95E:81332_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
hs |
HG-U95E:86819_R_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
hs |
HG-U95E:89658_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
hs |
HU35KSUBC:RC_H95037_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
hs |
HU35KSUBC:RC_N76059_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
hs |
U133_X3P:HS.118959.0.A1_3P_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
hs |
U133_X3P:HS.38540.0.A1_3P_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
hs |
MU11KSUBA:AA521793_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
mm |
MG-U74BV2:115824_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
mm |
MG-U74AV2:160711_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
mm |
MOE430A:1449443_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
mm |
MOUSE430A_2:1449443_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
mm |
MOUSE430_2:1449443_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
mm |
MOE430A:1419367_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
mm |
MOUSE430A_2:1419367_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
mm |
MOUSE430_2:1419367_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
mm |
MU19KSUBB:TC33801_AT |
2,4-dienoyl CoA reductase 1, mitochondrial (Decr1), mRNA |
mm |
RT-U34:D00569_G_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
rn |
RG-U34A:D00569_G_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
rn |
RT-U34:D00569_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
rn |
RG-U34A:D00569_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
rn |
RAE230A:1367777_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
rn |
RAT230_2:1367777_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
rn |
RAE230B:1394586_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
rn |
RAT230_2:1394586_AT |
2,4-dienoyl CoA reductase 1, mitochondrial |
rn | |
|
|
|
|
|
8152 |
metabolism |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
16491 |
oxidoreductase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAB02118 |
Hypothetical protein F53C11.3 [Caenorhabditis elegans] ref|NP_506413.1| F53C11.3 [Caenorhabditis elegans] sp|Q93761|YXEK_CAEEL Hypothetical oxidoreductase F53C11.3 |
1.0E-168 |
blast |
CAE66240 |
Hypothetical protein CBG11484 [Caenorhabditis briggsae] |
1.0E-160 |
blast |
CAA91310 |
Hypothetical protein T05C12.3 [Caenorhabditis elegans] ref|NP_495714.1| DYnein Light chain (Tctex type] family member (dylt-3) [Caenorhabditis elegans] sp|Q22230|YVX3_CAEEL Hypothetical oxidoreductase T05C12.3 |
1.0E-118 | |
|
|
|
|
|
Pfam |
IPR002198 EMBL-EBI |
Short-chain dehydrogenase/reductase SDR |
3.0E-51 | |
Sequence |
|
>C. ELEGANS:191783_AT
ttcatcatggcaaccgaacgtctctcaccgaatgcctacggtaccatcattgatatcgtt
ctgaaaggaactctccacgtcaccaccgagctcggccgtcgctgtattcaacaaaagcgt
ggagccagtgtgctcagcatcacaacactttatgcacaatctggtgcaccatttgtggtt
ccatcagcggtttcgaaggctggtgtcgaaaatatgacaaaatcattggcgtctgaatgg
gcgaaacacggattgcgattcaatgcgattgctcctggaccaattccaacagagggagca
ttcggaagattatttgccggggagttgaaggattctggagatgctatgaaagcatcagta
ccagttggaagacttgggcatccggaagaaattgccaatttggcagcgttcatgtcgtct
gatttcatgtcctggatgaatggagcgattatcgatttcgacggtggccaacagcacatt
catcatggatcccat
BLASTn GenBank NR |
|
|
|
|
|
|
TTCATCATGGCAACCGAACGTCTCT |
159 |
689 |
361 |
Antisense |
GTCTCTCACCGAATGCCTACGGTAC |
517 |
467 |
380 |
Antisense |
TCTGAAAGGAACTCTCCACGTCACC |
515 |
605 |
420 |
Antisense |
GTGGAGCCAGTGTGCTCAGCATCAC |
59 |
491 |
479 |
Antisense |
TGGTGCACCATTTGTGGTTCCATCA |
421 |
553 |
522 |
Antisense |
GGTTCCATCAGCGGTTTCGAAGGCT |
363 |
507 |
537 |
Antisense |
GATTCAATGCGATTGCTCCTGGACC |
389 |
431 |
617 |
Antisense |
CAATTTGGCAGCGTTCATGTCGTCT |
476 |
179 |
756 |
Antisense |
ATGTCGTCTGATTTCATGTCCTGGA |
338 |
49 |
772 |
Antisense |
TCGATTTCGACGGTGGCCAACAGCA |
637 |
601 |
812 |
Antisense |
ACAGCACATTCATCATGGATCCCAT |
380 |
107 |
831 |
Antisense | |
|
Affymetrix Proprietary Database | |