|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
191709_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.13257
|
|
Exemplar sequence
|
|
W08G11.4 NCBI
|
|
W08G11.4 /REP_DB=WormBase Gene ID /WP=CE16561 /TR=O18178 /GB=CAB07297.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=RTS1 PROTEIN (SCS1 PROTEIN)
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_074732(9) |
|
|
|
|
|
NM_074732 NCBI |
Caenorhabditis elegans W08G11.4 (W08G11.4) mRNA, complete cds. |
9/11 |
None |
SNAP00000011325 ENSEMBL |
cdna:SNAP chromosome:CEL140:V:16360235:16369244:1 |
9/11 |
None |
GENEFINDER00000011331 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:V:16360235:16369461:1 |
9/11 |
None |
W08G11.4 ENSEMBL |
cdna:known chromosome:CEL140:V:16360104:16370122:1 gene:W08G11.4 |
9/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrV:16360234-16367026(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
RTS1 PROTEIN (SCS1 PROTEIN)
|
|
W08G11.4
|
|
180100 Entrez gene
|
|
O18178 EMBL-EBI
|
|
CE32003 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:258176_AT |
serine/threonine protein phosphatase 2A (PP2A) regulatory subunit B', putative |
at |
CANINE:1605221_AT |
similar to epsilon isoform of regulatory subunit B56, protein phosphatase 2A |
cfa |
CANINE_2:CFA.1638.1.A1_AT |
similar to epsilon isoform of regulatory subunit B56, protein phosphatase 2A |
cfa |
CANINE_2:CFA.20148.1.S1_S_AT |
similar to epsilon isoform of regulatory subunit B56, protein phosphatase 2A |
cfa |
CANINE_2:CFAAFFX.24197.1.S1_S_AT |
similar to epsilon isoform of regulatory subunit B56, protein phosphatase 2A |
cfa |
DROSOPHILA_2:1629187_S_AT |
widerborst |
dm |
DROSOPHILA_2:1626385_S_AT |
widerborst |
dm |
DROSGENOME1:154680_AT |
widerborst |
dm |
CHICKEN:GGAAFFX.7523.1.S1_AT |
similar to epsilon isoform of regulatory subunit B56, protein phosphatase 2A; PP2A, B subunit, B epsilon isoform; PP2A, B subunit, B56 epsilon isoform; PP2A, B subunit, PR61 epsilon isoform; PP2A, B subunit, R5 epsilon isoform; Serine/threonine pro... |
gga |
HG-U95AV2:32734_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HG-FOCUS:203338_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HG-U133A_2:203338_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HG-U133A:203338_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HG-U133_PLUS_2:203338_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HUGENEFL:L76703_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
U133_X3P:G5453955_3P_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
U133_X3P:HS.319817.0.A1_3P_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HG-U133_PLUS_2:229322_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HG-U133B:229322_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HG-U95C:56629_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HG-U95C:56638_G_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HG-U133_PLUS_2:228070_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HG-U133B:228070_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HU35KSUBC:RC_AA455150_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
U133_X3P:HS2.435271.1.S1_3P_X_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
U133_X3P:HS.283362.0.A1_3P_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
U133_X3P:HS.122684.1.S1_3P_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
U133_X3P:1562817_3P_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HG-U133_PLUS_2:1562817_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HG-U133_PLUS_2:227630_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HG-U133B:227630_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HG-U95B:53735_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HG-U95E:76264_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HG-U133_PLUS_2:231101_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HG-U133B:231101_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HG-U95D:73779_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HG-U95E:78176_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HG-U95D:86965_R_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HU35KSUBA:AA056140_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
HU35KSUBA:AA056319_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
U133_X3P:HS.122684.0.A1_3P_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
hs |
MOUSE430_2:1428462_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
mm |
MOE430B:1428462_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
mm |
MOUSE430_2:1452788_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
mm |
MOE430B:1452788_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
mm |
MOUSE430_2:1428461_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
mm |
MOE430B:1428461_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
mm |
MOE430B:1428463_A_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
mm |
MOUSE430_2:1428463_A_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
mm |
MG-U74BV2:114061_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
mm |
MG-U74BV2:113530_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
mm |
MG-U74BV2:164820_I_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
mm |
MG-U74BV2:164150_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
mm |
MG-U74BV2:163059_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
mm |
MG-U74BV2:162885_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform |
mm |
MU11KSUBA:AA285426_AT |
MKIAA4006 protein |
mm |
MG-U74AV2:95955_AT |
MKIAA4006 protein |
mm |
MOE430A:1443949_AT |
MKIAA4006 protein |
mm |
MOUSE430A_2:1443949_AT |
MKIAA4006 protein |
mm |
MOUSE430_2:1443949_AT |
MKIAA4006 protein |
mm |
MOE430B:1439401_X_AT |
MKIAA4006 protein |
mm |
MOUSE430_2:1439401_X_AT |
MKIAA4006 protein |
mm |
MOUSE430_2:1443533_AT |
MKIAA4006 protein |
mm |
MOE430B:1443533_AT |
MKIAA4006 protein |
mm |
MOUSE430_2:1446356_AT |
MKIAA4006 protein |
mm |
MOE430B:1446356_AT |
MKIAA4006 protein |
mm |
MU19KSUBA:TC20678_AT |
MKIAA4006 protein |
mm |
MU19KSUBA:TC24810_AT |
MKIAA4006 protein |
mm |
MU19KSUBA:TC24993_AT |
MKIAA4006 protein |
mm |
MU19KSUBB:TC30640_AT |
MKIAA4006 protein |
mm |
MU19KSUBC:TC41843_AT |
MKIAA4006 protein |
mm |
RAE230A:1388965_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform (predicted) |
rn |
RAT230_2:1388965_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform (predicted) |
rn |
RAE230B:1395826_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform (predicted) |
rn |
RAT230_2:1395826_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform (predicted) |
rn |
RAE230B:1379554_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform (predicted) |
rn |
RAT230_2:1379554_AT |
protein phosphatase 2, regulatory subunit B (B56), epsilon isoform (predicted) |
rn |
RAE230B:1397605_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform (predicted) |
rn |
RAT230_2:1397605_AT |
Protein phosphatase 2, regulatory subunit B (B56), epsilon isoform (predicted) |
rn | |
|
|
|
|
|
7165 |
signal transduction |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
159 |
protein phosphatase type 2A complex |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
8601 |
protein phosphatase type 2A regulator activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAB07297 |
Hypothetical protein W08G11.4 [Caenorhabditis elegans] ref|NP_507133.2| W08G11.4 [Caenorhabditis elegans] |
0.0 |
blast |
EAA08635 |
ENSANGP00000020339 [Anopheles gambiae str. PEST] ref|XP_312967.2| ENSANGP00000020339 [Anopheles gambiae str. PEST] |
1.0E-176 |
blast |
AAN14118 |
CG5643-PG, isoform G [Drosophila melanogaster] gb|AAN14117.1| CG5643-PF, isoform F [Drosophila melanogaster] gb|AAN14116.1| CG5643-PE, isoform E [Drosophila melanogaster] gb|AAN14115.1| CG5643-PD, isoform D [Drosophila melanogaster] gb|AAN14114.1| CG5643-PC, isoform C [Drosophila melanogaster] gb|AAN14113.1| CG5643-PB, isoform B [Drosophila melanogaster] gb|AAF56720.2| CG5643-PA, isoform A [Drosophila melanogaster] ref|NP_733220.1| CG5643-PG, isoform G [Drosophila melanogaster] ref|NP_733219.1| CG5643-PF, isoform F [Drosophila melanogaster] ref|NP_733218.1| CG5643-PE, isoform E [Drosophila melanogaster] ref|NP_733217.1| CG5643-PD, isoform D [Drosophila melanogaster] ref|NP_733216.1| CG5643-PB, isoform B [Drosophila melanogaster] ref|NP_733215.1| CG5643-PA, isoform A [Drosophila melanogaster] ref|NP_651569.1| CG5643-PC, isoform C [Drosophila melanogaster] gb|AAD38671.1| BcDNA.LD34343 [Drosophila melanogaster] |
1.0E-176 | |
|
|
|
|
|
Pfam |
IPR002554 EMBL-EBI |
Protein phosphatase 2A, regulatory B subunit, B56 |
1.0E-126 |
Pfam |
IPR002554 EMBL-EBI |
Protein phosphatase 2A, regulatory B subunit, B56 |
1.0E-126 |
Pfam |
IPR002554 EMBL-EBI |
Protein phosphatase 2A, regulatory B subunit, B56 |
1.8E-97 | |
Sequence |
|
>C. ELEGANS:191709_AT
actattgctcaattttcgacggaaaaagaggttatgttcctgggtgaagtggaggaaatt
ctcgacattatcgaaccggaacaattcaaaaagattatcgatccattattccgtcaattg
gccaaatgtgtcagtagtccacattttcaagttgctgaacgggctctctacttttggaat
aatgaatatatattgtcattaattgaggatacaagcagtttggtgatgccgattatgttc
ccagcgctctatcggatttccaaagagcactggaatcaaacaattgttgcacttgtctat
aatgtactcaaaacttttatggaaatgaatggaaaactgtttgatgagcttacttctacg
tacaaaggtgaacgattgcgggaaaagcaacgagaaaaggatcgtgatgctttttggaag
aaaatggaagctcttgaattgaatccaccggctgaaggaaaagaagtgacaccttcgttg
tttccagagaagttgactgattatttgaagaaggttcgtgtggatttttggaga
BLASTn GenBank NR |
|
|
|
|
|
|
ACTATTGCTCAATTTTCGACGGAAA |
92 |
103 |
1042 |
Antisense |
GATTATCGATCCATTATTCCGTCAA |
410 |
429 |
1134 |
Antisense |
GATCCATTATTCCGTCAATTGGCCA |
71 |
417 |
1141 |
Antisense |
AATTGGCCAAATGTGTCAGTAGTCC |
78 |
179 |
1157 |
Antisense |
GTAGTCCACATTTTCAAGTTGCTGA |
258 |
457 |
1175 |
Antisense |
TTCAAGTTGCTGAACGGGCTCTCTA |
491 |
685 |
1187 |
Antisense |
ACGGGCTCTCTACTTTTGGAATAAT |
92 |
93 |
1200 |
Antisense |
TGGTGATGCCGATTATGTTCCCAGC |
491 |
553 |
1262 |
Antisense |
CAGCGCTCTATCGGATTTCCAAAGA |
575 |
203 |
1283 |
Antisense |
GTTGCACTTGTCTATAATGTACTCA |
207 |
439 |
1327 |
Antisense |
GAAGGTTCGTGTGGATTTTTGGAGA |
178 |
335 |
1551 |
Antisense | |
|
Affymetrix Proprietary Database | |