|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
191573_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.7792
|
|
Exemplar sequence
|
|
C34E10.6 NCBI
|
|
C34E10.6 /REP_DB=WormBase Gene ID /WP=CE01186 /TR=SW:P46561 /GB=AAA19068.1 /SUBMIT=ST.LOUIS /CHR=3 /FEA=Sanger Annotation /DEF=ATP synthase beta chain
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_065710(11) |
|
|
|
|
|
NM_065710 NCBI |
Caenorhabditis elegans ATP synthase subunit family member (atp-2) (atp-2) mRNA, complete cds. |
11/11 |
None |
GENEFINDER00000034371 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:III:5228094:5230192:1 |
11/11 |
None |
SNAP00000034352 ENSEMBL |
cdna:SNAP chromosome:CEL140:III:5228374:5230192:1 |
11/11 |
None |
C34E10.6.3 ENSEMBL |
cdna:known chromosome:CEL140:III:5228368:5230501:1 gene:C34E10.6 |
11/11 |
None |
C34E10.6.2 ENSEMBL |
cdna:known chromosome:CEL140:III:5228372:5230501:1 gene:C34E10.6 |
11/11 |
None |
C34E10.6.4 ENSEMBL |
cdna:known chromosome:CEL140:III:5228374:5230489:1 gene:C34E10.6 |
11/11 |
None |
C34E10.6.1 ENSEMBL |
cdna:known chromosome:CEL140:III:5228374:5230501:1 gene:C34E10.6 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIII:5228092-5230191(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
ATP synthase beta chain
|
|
atp-2
|
|
C34E10.6
|
|
175716 Entrez gene
|
|
P46561 EMBL-EBI
|
|
CE29950 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:245715_S_AT |
ATP synthase beta chain 1, mitochondrial |
at |
CANINE:1589422_S_AT |
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide |
cfa |
CANINE_2:CFA.1251.1.S1_AT |
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide |
cfa |
CANINE_2:CFAAFFX.1181.1.S1_S_AT |
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide |
cfa |
DROSOPHILA_2:1633673_A_AT |
ATP synthase- |
dm |
DROSOPHILA_2:1630984_AT |
ATP synthase- |
dm |
DROSGENOME1:143586_AT |
ATP synthase- |
dm |
CHICKEN:GGA.4809.1.S1_S_AT |
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide |
gga |
HG-U133_PLUS_2:201322_AT |
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide |
hs |
HG-U133A:201322_AT |
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide |
hs |
HG-U133A_2:201322_AT |
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide |
hs |
HG-FOCUS:201322_AT |
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide |
hs |
HUGENEFL:M19483_AT |
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide |
hs |
U133_X3P:G4502294_3P_AT |
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide |
hs |
HG-U95AV2:41357_AT |
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide |
hs |
MU11KSUBA:AF030559_AT |
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit |
mm |
MU11KSUBB:MSA.16991.0_F_AT |
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit |
mm |
MU11KSUBB:MSA.40668.0_F_AT |
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit |
mm |
MU11KSUBB:MSA.31336.0_F_AT |
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit |
mm |
MU11KSUBB:MSA.28302.0_F_AT |
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit |
mm |
MU11KSUBB:MSA.12621.0_F_AT |
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit |
mm |
MU11KSUBB:MSA.7019.0_F_AT |
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit |
mm |
MOE430A:1416829_AT |
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit |
mm |
MOUSE430A_2:1416829_AT |
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit |
mm |
MOUSE430_2:1416829_AT |
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit |
mm |
MU11KSUBB:MSA.33147.0_S_AT |
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit, mRNA (cDNA clone IMAGE:4920887) |
mm |
MU19KSUBA:TC22597_F_AT |
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit, mRNA (cDNA clone IMAGE:4920887) |
mm |
MU19KSUBC:TC36156_AT |
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit, mRNA (cDNA clone IMAGE:4920887) |
mm |
MU19KSUBC:TC38038_AT |
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit, mRNA (cDNA clone IMAGE:4920887) |
mm |
MU19KSUBC:TC39488_S_AT |
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit, mRNA (cDNA clone IMAGE:4920887) |
mm |
MU19KSUBC:TC40530_F_AT |
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit, mRNA (cDNA clone IMAGE:4920887) |
mm |
MU19KSUBC:TC40531_F_AT |
ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit, mRNA (cDNA clone IMAGE:4920887) |
mm |
RG-U34A:RC_AI105050_AT |
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide |
rn |
RAE230A:1370275_AT |
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide |
rn |
RAT230_2:1370275_AT |
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide |
rn |
RAE230B:1380070_AT |
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide |
rn |
RAT230_2:1380070_AT |
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide |
rn |
YEAST_2:1770250_AT |
Beta subunit of the F1 sector of mitochondrial F1F0 ATP synthase, which is a large, evolutionarily conserved enzyme complex required for ATP synthesis |
Sc | |
|
|
|
|
|
6754 |
ATP biosynthesis |
inferred from electronic annotation |
QuickGO AmiGO |
15986 |
ATP synthesis coupled proton transport |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
16021 |
integral to membrane |
inferred from electronic annotation |
QuickGO AmiGO |
16469 |
proton-transporting two-sector ATPase complex |
inferred from electronic annotation |
QuickGO AmiGO |
45255 |
hydrogen-translocating F-type ATPase complex |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
166 |
nucleotide binding |
inferred from electronic annotation |
QuickGO AmiGO |
5524 |
ATP binding |
inferred from electronic annotation |
QuickGO AmiGO |
8553 |
hydrogen-exporting ATPase activity, phosphorylative mechanism |
inferred from electronic annotation |
QuickGO AmiGO |
46933 |
hydrogen-transporting ATP synthase activity, rotational mechanism |
inferred from electronic annotation |
QuickGO AmiGO |
46961 |
hydrogen-transporting ATPase activity, rotational mechanism |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
AAA19068 |
Atp synthase subunit protein 2 [Caenorhabditis elegans] ref|NP_498111.2| ATP synthase subunit family member (atp-2) [Caenorhabditis elegans] sp|P46561|ATPB_CAEEL ATP synthase beta chain, mitochondrial precursor |
0.0 |
blast |
T15763 |
hypothetical protein C34E10.6 - Caenorhabditis elegans |
0.0 |
blast |
CAE73664 |
Hypothetical protein CBG21173 [Caenorhabditis briggsae] |
0.0 | |
|
|
|
|
|
Pfam |
IPR004100 EMBL-EBI |
H+-transporting two-sector ATPase, alpha/beta subunit, N-terminal |
7.8E-28 |
Pfam |
IPR000194 EMBL-EBI |
H+-transporting two-sector ATPase, alpha/beta subunit, central region |
9.0E-83 |
Pfam |
IPR000793 EMBL-EBI |
H+-transporting two-sector ATPase, alpha/beta subunit, C-terminal |
9.9E-51 |
Pfam |
IPR004100 EMBL-EBI |
H+-transporting two-sector ATPase, alpha/beta subunit, N-terminal |
7.8E-28 |
Pfam |
IPR000194 EMBL-EBI |
H+-transporting two-sector ATPase, alpha/beta subunit, central region |
9.0E-83 |
Pfam |
IPR000793 EMBL-EBI |
H+-transporting two-sector ATPase, alpha/beta subunit, C-terminal |
9.9E-51 |
Pfam |
IPR004100 EMBL-EBI |
H+-transporting two-sector ATPase, alpha/beta subunit, N-terminal |
7.8E-28 |
Pfam |
IPR000194 EMBL-EBI |
H+-transporting two-sector ATPase, alpha/beta subunit, central region |
9.0E-83 |
Pfam |
IPR000793 EMBL-EBI |
H+-transporting two-sector ATPase, alpha/beta subunit, C-terminal |
9.9E-51 | |
Sequence |
|
>C. ELEGANS:191573_S_AT
ccaacccttgccactgacatgggaagtatgcaagagagaattaccaccaccaagaaggga
tccatcacatccgtccaggctatttacgtacctgctgacgatttgactgatccagctcca
gctaccacattcgctcacttggacgccaccactgtcttgtcccgtggtattgccgaattg
gctatctacccagctgtcgatccacttgactccacctcccgtatcatggaccccaacgtt
gtcggacagaaccactacgacattgctcgtggagttcaaaagatcctccaagattacaag
tccctccaagatattattgctattcttggtatggatgagttgtccgaggaagacaagctt
accgtttcacgtgcccgcaagatccaacgtttcctttcccaaccattccaagtcgctgag
gtgttcactggacatcaaggaaagttcgtatcactcgaagagacaatccgcggtttcacc
atgattctcaagggagaactcgaccaccttccagaagttgct
BLASTn GenBank NR |
|
|
|
|
|
|
CCAACCCTTGCCACTGACATGGGAA |
519 |
275 |
1132 |
Antisense |
ATCCGTCCAGGCTATTTACGTACCT |
680 |
1 |
1200 |
Antisense |
TGACGATTTGACTGATCCAGCTCCA |
202 |
571 |
1227 |
Antisense |
CTTGTCCCGTGGTATTGCCGAATTG |
468 |
217 |
1287 |
Antisense |
GACAGAACCACTACGACATTGCTCG |
8 |
369 |
1376 |
Antisense |
CTCCAAGATTACAAGTCCCTCCAAG |
658 |
233 |
1417 |
Antisense |
AAGACAAGCTTACCGTTTCACGTGC |
600 |
151 |
1481 |
Antisense |
CCCAACCATTCCAAGTCGCTGAGGT |
126 |
259 |
1529 |
Antisense |
GTCGCTGAGGTGTTCACTGGACATC |
545 |
473 |
1543 |
Antisense |
CGAAGAGACAATCCGCGGTTTCACC |
150 |
253 |
1587 |
Antisense |
ACTCGACCACCTTCCAGAAGTTGCT |
242 |
99 |
1629 |
Antisense | |
|
Affymetrix Proprietary Database | |