|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
191489_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.1529
|
|
Exemplar sequence
|
|
ZK524.2A NCBI
|
|
ZK524.2A /REP_DB=WormBase Gene ID /WP=CE15371 /GEN=unc-13 /TR=O17665 /GB=CAA98147.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation /DEF=UNC-13 protein
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001026703(11), NM_001026702(11), NM_001026700(11), NM_001026701(11) |
|
|
|
|
|
NM_001026703 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-13) (unc-13) mRNA, complete cds. |
11/11 |
None |
NM_001026702 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-13) (unc-13) mRNA, complete cds. |
11/11 |
None |
NM_001026700 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-13) (unc-13) mRNA, complete cds. |
11/11 |
None |
NM_001026701 NCBI |
Caenorhabditis elegans UNCoordinated family member (unc-13) (unc-13) mRNA, complete cds. |
11/11 |
None |
GENEFINDER00000017083 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:I:7453508:7462030:1 |
11/11 |
None |
SNAP00000017079 ENSEMBL |
cdna:SNAP chromosome:CEL140:I:7458440:7461857:1 |
11/11 |
None |
ZK524.2d ENSEMBL |
cdna:known chromosome:CEL140:I:7430913:7461857:1 gene:ZK524.2 |
11/11 |
A |
ZK524.2e ENSEMBL |
cdna:known chromosome:CEL140:I:7430913:7462216:1 gene:ZK524.2 |
11/11 |
A |
ZK524.2a ENSEMBL |
cdna:known chromosome:CEL140:I:7430913:7461857:1 gene:ZK524.2 |
11/11 |
A |
ZK524.2c ENSEMBL |
cdna:known chromosome:CEL140:I:7441545:7461857:1 gene:ZK524.2 |
11/11 |
A |
ZK524.2b ENSEMBL |
cdna:known chromosome:CEL140:I:7451297:7461857:1 gene:ZK524.2 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:7430843-7461788(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
ZK524.2
|
Functional Annotations |
|
|
|
|
|
blast |
CAE11299 |
Hypothetical protein ZK524.2e [Caenorhabditis elegans] emb|CAE11317.1| Hypothetical protein ZK524.2e [Caenorhabditis elegans] emb|CAE11294.1| Hypothetical protein ZK524.2e [Caenorhabditis elegans] ref|NP_001021874.1| UNCoordinated family member (unc-13) [Caenorhabditis elegans] |
0.0 |
blast |
CAB01966 |
Hypothetical protein ZK524.2a [Caenorhabditis elegans] emb|CAA98147.1| Hypothetical protein ZK524.2a [Caenorhabditis elegans] emb|CAB07173.1| Hypothetical protein ZK524.2a [Caenorhabditis elegans] ref|NP_001021871.1| UNCoordinated family member (unc-13) [Caenorhabditis elegans] |
0.0 |
blast |
AAA93094 |
UNC-13 |
0.0 |
blast |
CAD90170 |
Hypothetical protein ZK524.2d [Caenorhabditis elegans] emb|CAD90190.2| Hypothetical protein ZK524.2d [Caenorhabditis elegans] emb|CAD90173.2| Hypothetical protein ZK524.2d [Caenorhabditis elegans] ref|NP_001021873.1| UNCoordinated family member (unc-13) [Caenorhabditis elegans] sp|P27715|UNC13_CAEEL Phorbol ester/diacylglycerol-binding protein unc-13 (Uncoordinated protein 13) |
0.0 |
blast |
CAD56619 |
Hypothetical protein ZK524.2c [Caenorhabditis elegans] emb|CAD56561.2| Hypothetical protein ZK524.2c [Caenorhabditis elegans] ref|NP_001021872.1| UNCoordinated family member (unc-13) [Caenorhabditis elegans] |
0.0 | |
|
|
|
|
|
Pfam |
IPR010439 EMBL-EBI |
Protein of unknown function DUF1041 |
9.0E-79 |
Pfam |
IPR010439 EMBL-EBI |
Protein of unknown function DUF1041 |
2.8E-74 |
Pfam |
IPR002219 EMBL-EBI |
Protein kinase C, phorbol ester/diacylglycerol binding |
4.1E-23 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
2.1E-6 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
5.8E-32 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
2.4E-17 |
Pfam |
IPR010439 EMBL-EBI |
Protein of unknown function DUF1041 |
9.0E-79 |
Pfam |
IPR010439 EMBL-EBI |
Protein of unknown function DUF1041 |
2.8E-74 |
Pfam |
IPR002219 EMBL-EBI |
Protein kinase C, phorbol ester/diacylglycerol binding |
4.1E-23 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
5.8E-32 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
2.4E-17 |
Pfam |
IPR010439 EMBL-EBI |
Protein of unknown function DUF1041 |
9.0E-79 |
Pfam |
IPR010439 EMBL-EBI |
Protein of unknown function DUF1041 |
2.8E-74 |
Pfam |
IPR002219 EMBL-EBI |
Protein kinase C, phorbol ester/diacylglycerol binding |
4.1E-23 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
5.8E-32 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
2.4E-17 |
Pfam |
IPR010439 EMBL-EBI |
Protein of unknown function DUF1041 |
9.0E-79 |
Pfam |
IPR010439 EMBL-EBI |
Protein of unknown function DUF1041 |
2.8E-74 |
Pfam |
IPR002219 EMBL-EBI |
Protein kinase C, phorbol ester/diacylglycerol binding |
4.1E-23 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
5.8E-32 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
2.4E-17 |
Pfam |
IPR010439 EMBL-EBI |
Protein of unknown function DUF1041 |
9.0E-79 |
Pfam |
IPR010439 EMBL-EBI |
Protein of unknown function DUF1041 |
2.8E-74 |
Pfam |
IPR002219 EMBL-EBI |
Protein kinase C, phorbol ester/diacylglycerol binding |
4.1E-23 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
5.8E-32 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
2.4E-17 |
Pfam |
IPR010439 EMBL-EBI |
Protein of unknown function DUF1041 |
3.0E-35 |
Pfam |
IPR010439 EMBL-EBI |
Protein of unknown function DUF1041 |
2.8E-74 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
2.4E-17 |
Pfam |
IPR010439 EMBL-EBI |
Protein of unknown function DUF1041 |
9.0E-79 |
Pfam |
IPR010439 EMBL-EBI |
Protein of unknown function DUF1041 |
2.8E-74 |
Pfam |
IPR002219 EMBL-EBI |
Protein kinase C, phorbol ester/diacylglycerol binding |
4.1E-23 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
5.8E-32 |
Pfam |
IPR000008 EMBL-EBI |
C2 domain |
2.4E-17 | |
Sequence |
|
>C. ELEGANS:191489_S_AT
gacttattcagtcatccaggcactggggaacagaaggttaccgttaaaatccttgccgca
aacgatcttcgatggcaaacctcgtcagctttcaaaccatttgttgaagtgcatcttgtc
ggaccacatctttcagacaaaaagagaaaatggtcgacaaagaccaaagcaggcaactgg
gctccaaaattcaacgaaacttttcatttcttccttggaaatgaaggagaacctgaacat
tacgagcttatgtttcaagtcaaggattactgttttgcacgagatgatcgagttgttgga
gttggagttctgcagttatcatctgtcgttgatcaagcgggatcctgcgccatgtgggtt
caacttggaactcgactgcatatcgacgagactgggctcattttgctcaggattctttca
cagcgtca
BLASTn GenBank NR |
|
|
|
|
|
|
GACTTATTCAGTCATCCAGGCACTG |
116 |
373 |
4918 |
Antisense |
CCTTGCCGCAAACGATCTTCGATGG |
632 |
269 |
4968 |
Antisense |
TCTTCGATGGCAAACCTCGTCAGCT |
590 |
617 |
4983 |
Antisense |
CCTCGTCAGCTTTCAAACCATTTGT |
536 |
267 |
4997 |
Antisense |
TCTTGTCGGACCACATCTTTCAGAC |
259 |
617 |
5031 |
Antisense |
GACCAAAGCAGGCAACTGGGCTCCA |
21 |
383 |
5079 |
Antisense |
GAGTTCTGCAGTTATCATCTGTCGT |
166 |
399 |
5222 |
Antisense |
ATCCTGCGCCATGTGGGTTCAACTT |
556 |
39 |
5259 |
Antisense |
TCAACTTGGAACTCGACTGCATATC |
255 |
629 |
5277 |
Antisense |
GACGAGACTGGGCTCATTTTGCTCA |
569 |
377 |
5302 |
Antisense |
TGCTCAGGATTCTTTCACAGCGTCA |
133 |
581 |
5321 |
Antisense | |
|
Affymetrix Proprietary Database |