|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
190918_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.2364
|
|
Exemplar sequence
|
|
Y37H9A.6 NCBI
|
|
Y37H9A.6 /REP_DB=WormBase Gene ID /WP=CE20230 /TR=Q9U2M7 /GB=CAB63351.1 /SUBMIT=HINXTON /CHR=1 /FEA=Sanger Annotation /DEF=Bacterial mutT protein
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_061012(11) |
|
|
|
|
|
NM_061012 NCBI |
Caenorhabditis elegans NuDiX family member (ndx-4) (ndx-4) mRNA, complete cds. |
11/11 |
None |
GENEFINDER00000010053 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:I:13800857:13805709:-1 |
11/11 |
None |
Y37H9A.6.1 ENSEMBL |
cdna:known chromosome:CEL140:I:13800763:13802270:-1 gene:Y37H9A.6 |
11/11 |
None |
Y37H9A.6.2 ENSEMBL |
cdna:known chromosome:CEL140:I:13800776:13802272:-1 gene:Y37H9A.6 |
11/11 |
None | |
SNAP00000010048 |
6/11 |
Cross Hyb Matching Probes |
None | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:13800787-13802189(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
Bacterial mutT protein
|
|
ndx-4
|
|
Y37H9A.6
|
|
189639 Entrez gene
|
|
Q9U2M7 EMBL-EBI
|
|
CE20230 Wormbase
|
Functional Annotations |
|
|
|
|
CANINE:1585352_S_AT |
similar to Bis(5-nucleosyl)-tetraphosphatase [Asymmetrical] (Diadenosine 5,5-P1,P4-tetraphosphate asymmetrical hydrolase) (Diadenosine tetraphosphatase) (Ap4A hydrolase) (Ap4Aase) (Nucleoside diphosphate-linked moiety X motif 2) (Nudix motif 2)... |
cfa |
CANINE_2:CFA.11231.1.A1_AT |
similar to Bis(5-nucleosyl)-tetraphosphatase [Asymmetrical] (Diadenosine 5,5-P1,P4-tetraphosphate asymmetrical hydrolase) (Diadenosine tetraphosphatase) (Ap4A hydrolase) (Ap4Aase) (Nucleoside diphosphate-linked moiety X motif 2) (Nudix motif 2)... |
cfa |
CANINE_2:CFAAFFX.3791.1.S1_AT |
similar to Bis(5-nucleosyl)-tetraphosphatase [Asymmetrical] (Diadenosine 5,5-P1,P4-tetraphosphate asymmetrical hydrolase) (Diadenosine tetraphosphatase) (Ap4A hydrolase) (Ap4Aase) (Nucleoside diphosphate-linked moiety X motif 2) (Nudix motif 2)... |
cfa |
CANINE_2:CFAAFFX.3791.1.S1_S_AT |
similar to Bis(5-nucleosyl)-tetraphosphatase [Asymmetrical] (Diadenosine 5,5-P1,P4-tetraphosphate asymmetrical hydrolase) (Diadenosine tetraphosphatase) (Ap4A hydrolase) (Ap4Aase) (Nucleoside diphosphate-linked moiety X motif 2) (Nudix motif 2)... |
cfa |
CHICKEN:GGA.12541.1.S1_AT |
nudix (nucleoside diphosphate linked moiety X)-type motif 2 |
gga |
HG-U133_PLUS_2:218609_S_AT |
nudix (nucleoside diphosphate linked moiety X)-type motif 2 |
hs |
HG-U133A:218609_S_AT |
nudix (nucleoside diphosphate linked moiety X)-type motif 2 |
hs |
HG-FOCUS:218609_S_AT |
nudix (nucleoside diphosphate linked moiety X)-type motif 2 |
hs |
HG-U133A_2:218609_S_AT |
nudix (nucleoside diphosphate linked moiety X)-type motif 2 |
hs |
HUGENEFL:U30313_AT |
nudix (nucleoside diphosphate linked moiety X)-type motif 2 |
hs |
U133_X3P:G4502124_3P_S_AT |
nudix (nucleoside diphosphate linked moiety X)-type motif 2 |
hs |
HG-U95E:78494_AT |
nudix (nucleoside diphosphate linked moiety X)-type motif 2 |
hs |
MG-U74BV2:108551_AT |
nudix (nucleoside diphosphate linked moiety X)-type motif 2 |
mm |
MOE430A:1418737_AT |
nudix (nucleoside diphosphate linked moiety X)-type motif 2 |
mm |
MOUSE430A_2:1418737_AT |
nudix (nucleoside diphosphate linked moiety X)-type motif 2 |
mm |
MOUSE430_2:1418737_AT |
nudix (nucleoside diphosphate linked moiety X)-type motif 2 |
mm |
MU19KSUBB:TC30850_AT |
Nudix (nucleoside diphosphate linked moiety X)-type motif 2, mRNA (cDNA clone MGC:35745 IMAGE:4236805) |
mm |
RG-U34B:RC_AA924072_AT |
nudix (nucleoside diphosphate linked moiety X)-type motif 2 |
rn |
RAE230B:1377602_AT |
nudix (nucleoside diphosphate linked moiety X)-type motif 2 |
rn |
RAT230_2:1377602_AT |
nudix (nucleoside diphosphate linked moiety X)-type motif 2 |
rn |
RG-U34C:RC_AI236901_AT |
Nudix (nucleoside diphosphate linked moiety X)-type motif 2 |
rn | |
|
|
|
|
|
8796 |
bis(5'-nucleosyl)-tetraphosphatase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAB63351 |
Hypothetical protein Y37H9A.6 [Caenorhabditis elegans] ref|NP_493413.1| NuDiX family member (ndx-4) [Caenorhabditis elegans] sp|Q9U2M7|AP4A_CAEEL Bis(5'-nucleosyl)-tetraphosphatase [Asymmetrical] (Diadenosine 5',5'''-P1,P4-tetraphosphate asymmetrical hydrolase) (Diadenosine tetraphosphatase) (Ap4A hydrolase) (Ap4Aase) pdb|1KTG|B Chain B, Crystal Structure Of A C. Elegans Ap4a Hydrolase Binary Complex pdb|1KTG|A Chain A, Crystal Structure Of A C. Elegans Ap4a Hydrolase Binary Complex pdb|1KT9|A Chain A, Crystal Structure Of C. Elegans Ap4a Hydrolase |
7.0E-79 |
blast |
CAB63351 |
Hypothetical protein Y37H9A.6 [Caenorhabditis elegans] ref|NP_493413.1| NuDiX family member (ndx-4) [Caenorhabditis elegans] sp|Q9U2M7|AP4A_CAEEL Bis(5'-nucleosyl)-tetraphosphatase [Asymmetrical] (Diadenosine 5',5'''-P1,P4-tetraphosphate asymmetrical hydrolase) (Diadenosine tetraphosphatase) (Ap4A hydrolase) (Ap4Aase) pdb|1KTG|B Chain B, Crystal Structure Of A C. Elegans Ap4a Hydrolase Binary Complex pdb|1KTG|A Chain A, Crystal Structure Of A C. Elegans Ap4a Hydrolase Binary Complex pdb|1KT9|A Chain A, Crystal Structure Of C. Elegans Ap4a Hydrolase |
8.0E-78 |
blast |
CAE68019 |
Hypothetical protein CBG13634 [Caenorhabditis briggsae] |
5.0E-70 |
blast |
CAE68019 |
Hypothetical protein CBG13634 [Caenorhabditis briggsae] |
5.0E-69 |
blast |
AAK73892 |
Hypothetical protein T06A10.2 [Caenorhabditis elegans] ref|NP_503001.3| T06A10.2 [Caenorhabditis elegans] |
2.0E-60 |
blast |
EAA12242 |
ENSANGP00000019921 [Anopheles gambiae str. PEST] ref|XP_316948.2| ENSANGP00000019921 [Anopheles gambiae str. PEST] |
4.0E-34 | |
|
|
|
|
|
Pfam |
IPR002673 EMBL-EBI |
Ribosomal L29e protein |
5.1E-11 |
Pfam |
IPR000086 EMBL-EBI |
NUDIX hydrolase |
2.1E-25 |
Pfam |
IPR000086 EMBL-EBI |
NUDIX hydrolase |
2.1E-25 |
GENEFINDER00000010053 |
2 |
72-94,101-123 | |
Sequence |
|
>C. ELEGANS:190918_AT
aaaagccgcgggacttgtgatctaccggaagttggcgggaaaaatcgagtttctcctgct
tcaagcctcctatccaccacatcactggaccccaccaaaaggtcacgtggatccaggaga
agatgaatggcaggcggcaattcgtgagactaaggaagaagctaatattacaaaagagca
actgacaattcatgaagattgtcatgaaacactcttttatgaggcaaaagggaagccaaa
atcagtgaaatattggctcgccaagctcaacaatccagacgacgttcaactatctcatga
acatcaaaattggaaatggtgtgaattggaagatgctatcaaaattgccgattacgctga
aatgggcagccttctccgc
BLASTn GenBank NR |
|
|
|
|
|
|
AAAAGCCGCGGGACTTGTGATCTAC |
239 |
131 |
21 |
Antisense |
GTGATCTACCGGAAGTTGGCGGGAA |
189 |
485 |
37 |
Antisense |
AAAATCGAGTTTCTCCTGCTTCAAG |
106 |
133 |
61 |
Antisense |
CACTGGACCCCACCAAAAGGTCACG |
369 |
197 |
103 |
Antisense |
AAAGGTCACGTGGATCCAGGAGAAG |
516 |
121 |
118 |
Antisense |
ATGGCAGGCGGCAATTCGTGAGACT |
266 |
53 |
147 |
Antisense |
AATCAGTGAAATATTGGCTCGCCAA |
306 |
169 |
260 |
Antisense |
CTCGCCAAGCTCAACAATCCAGACG |
209 |
233 |
277 |
Antisense |
TCCAGACGACGTTCAACTATCTCAT |
708 |
589 |
294 |
Antisense |
CAAAATTGCCGATTACGCTGAAATG |
483 |
189 |
360 |
Antisense |
CGCTGAAATGGGCAGCCTTCTCCGC |
535 |
253 |
375 |
Antisense | |
|
Affymetrix Proprietary Database |