|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
190883_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.2887
|
|
Exemplar sequence
|
|
ZK970.4 NCBI
|
|
ZK970.4 /REP_DB=WormBase Gene ID /WP=CE02404 /TR=SW:Q23680 /GB=CAA88888.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation /DEF=H+-transporting ATPase
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_063816(11) |
|
|
|
|
|
NM_063816 NCBI |
Caenorhabditis elegans Vacuolar H ATPase family member (vha-9) (vha-9) mRNA, complete cds. |
11/11 |
None |
SNAP00000004311 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:10303112:10303623:-1 |
11/11 |
None |
GENEFINDER00000004322 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:10303112:10303623:-1 |
11/11 |
None |
ZK970.4.2 ENSEMBL |
cdna:known chromosome:CEL140:II:10302455:10303623:-1 gene:ZK970.4 |
11/11 |
None |
ZK970.4.1 ENSEMBL |
cdna:known chromosome:CEL140:II:10302455:10303680:-1 gene:ZK970.4 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:10303108-10303620(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
H+-transporting ATPase
|
|
vha-9
|
|
ZK970.4
|
|
174596 Entrez gene
|
|
Q23680 EMBL-EBI
|
|
CE02404 Wormbase
|
Functional Annotations |
|
|
|
|
ATGENOME1:13574_AT |
vacuolar ATPase subunit F family protein |
at |
ATH1-121501:255498_AT |
vacuolar ATPase subunit F family protein |
at |
CANINE:1584929_AT |
similar to ATPase, H+ transporting, V1 subunit F |
cfa |
CANINE_2:CFA.1409.1.A1_AT |
similar to ATPase, H+ transporting, V1 subunit F |
cfa |
CANINE_2:CFA.1409.1.A1_S_AT |
similar to ATPase, H+ transporting, V1 subunit F |
cfa |
DROSOPHILA_2:1639788_AT |
Vacuolar H+ ATPase 14kD subunit |
dm |
DROSGENOME1:143625_AT |
Vacuolar H+ ATPase 14kD subunit |
dm |
HG-U133A:201527_AT |
ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F |
hs |
HG-U133_PLUS_2:201527_AT |
ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F |
hs |
HG-U133A_2:201527_AT |
ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F |
hs |
HG-FOCUS:201527_AT |
ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F |
hs |
HU35KSUBD:RC_H94460_S_AT |
ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F |
hs |
HUGENEFL:D49400_AT |
ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F |
hs |
U133_X3P:G4757819_3P_X_AT |
ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F |
hs |
U133_X3P:G4757819_3P_AT |
ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F |
hs |
HG-U95AV2:37395_AT |
ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F |
hs |
U133_X3P:HS2.287138.1.A1_3P_AT |
ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F |
hs |
HG-U133_PLUS_2:1556956_AT |
ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F |
hs |
MU11KSUBB:MSA.9086.0_F_AT |
ATPase, H+ transporting, V1 subunit F |
mm |
MU11KSUBB:MSA.33596.0_F_AT |
ATPase, H+ transporting, V1 subunit F |
mm |
MG-U74CV2:168588_AT |
ATPase, H+ transporting, V1 subunit F |
mm |
MG-U74CV2:170348_I_AT |
ATPase, H+ transporting, V1 subunit F |
mm |
MOE430A:1423993_AT |
ATPase, H+ transporting, V1 subunit F |
mm |
MOUSE430A_2:1423993_AT |
ATPase, H+ transporting, V1 subunit F |
mm |
MOUSE430_2:1423993_AT |
ATPase, H+ transporting, V1 subunit F |
mm |
MU19KSUBC:TC39820_AT |
ATPase, H+ transporting, V1 subunit F (Atp6v1f), mRNA |
mm |
RG-U34A:U43175_AT |
ATPase, H+ transporting, V1 subunit F |
rn |
RAE230A:1398781_AT |
ATPase, H+ transporting, V1 subunit F |
rn |
RAT230_2:1398781_AT |
ATPase, H+ transporting, V1 subunit F |
rn |
YEAST_2:1778896_AT |
Subunit F of the eight-subunit V1 peripheral membrane domain of vacuolar H+-ATPase (V-ATPase), an electrogenic proton pump found throughout the endomembrane system; required for the V1 domain to assemble onto the vacuolar membrane |
Sc | |
|
|
|
|
|
15986 |
ATP synthesis coupled proton transport |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
16469 |
proton-transporting two-sector ATPase complex |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
46933 |
hydrogen-transporting ATP synthase activity, rotational mechanism |
inferred from electronic annotation |
QuickGO AmiGO |
46961 |
hydrogen-transporting ATPase activity, rotational mechanism |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAA88888 |
Hypothetical protein ZK970.4 [Caenorhabditis elegans] ref|NP_496217.1| Vacuolar H ATPase family member (vha-9) [Caenorhabditis elegans] sp|Q23680|VATF_CAEEL Probable vacuolar ATP synthase subunit F (V-ATPase F subunit) (Vacuolar proton pump F subunit) (V-ATPase 14 kDa subunit) |
8.0E-55 |
blast |
CAE57827 |
Hypothetical protein CBG00852 [Caenorhabditis briggsae] |
2.0E-52 | |
|
|
|
|
|
Pfam |
IPR008218 EMBL-EBI |
Vacuolar H+-transporting two-sector ATPase, F subunit |
1.6E-56 | |
Sequence |
|
>C. ELEGANS:190883_S_AT
atggcatctgctgcgaagggtaagattttggctgtcatcggagacgaagataccgttgtt
ggatttcttctcggaggtgttggagagcttaacaaggctcgcaagccaaactatttgatc
gtcgataagcagaccactgtccaagaaatcgaagaagctttcaatggattctgtgctcgt
gatgatattgctatcattcttatcaatcagcacatcgccgaaatgattcgttacgccgtc
gacaatcacacacaatctatcccagctgttcttgaaatcccatcgaaggaagctccatac
gatccatcgaaggactccatcctcaac
BLASTn GenBank NR |
|
|
|
|
|
|
ATGGCATCTGCTGCGAAGGGTAAGA |
387 |
51 |
13 |
Antisense |
GATTTTGGCTGTCATCGGAGACGAA |
586 |
427 |
36 |
Antisense |
GATACCGTTGTTGGATTTCTTCTCG |
339 |
425 |
61 |
Antisense |
GAGAGCTTAACAAGGCTCGCAAGCC |
184 |
395 |
95 |
Antisense |
GTCGATAAGCAGACCACTGTCCAAG |
406 |
473 |
133 |
Antisense |
CAATGGATTCTGTGCTCGTGATGAT |
614 |
181 |
174 |
Antisense |
CATTCTTATCAATCAGCACATCGCC |
237 |
215 |
207 |
Antisense |
GTCGACAATCACACACAATCTATCC |
268 |
475 |
250 |
Antisense |
ATCTATCCCAGCTGTTCTTGAAATC |
108 |
31 |
267 |
Antisense |
GAAGGAAGCTCCATACGATCCATCG |
705 |
333 |
297 |
Antisense |
TCCATCGAAGGACTCCATCCTCAAC |
413 |
589 |
315 |
Antisense | |
|
Affymetrix Proprietary Database | |