|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
190263_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.2608
|
|
Exemplar sequence
|
|
ZK970.2 NCBI
|
|
ZK970.2 /REP_DB=WormBase Gene ID /WP=CE02402 /TR=SW:Q27539 /GB=CAA88886.1 /SUBMIT=HINXTON /CHR=2 /FEA=Sanger Annotation /DEF=CLPP-like protease
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_063814(11) |
|
|
|
|
|
NM_063814 NCBI |
Caenorhabditis elegans ZK970.2 (ZK970.2) mRNA, complete cds. |
11/11 |
A |
SNAP00000004309 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:10300734:10302737:-1 |
11/11 |
None |
GENEFINDER00000004328 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:10301829:10302692:-1 |
11/11 |
None |
ZK970.2 ENSEMBL |
cdna:known chromosome:CEL140:II:10300699:10302769:-1 gene:ZK970.2 |
11/11 |
A | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:10300730-10302689(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
CLPP-like protease
|
|
ZK970.2
|
|
174594 Entrez gene
|
|
Q27539 EMBL-EBI
|
|
CE02402 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:249873_AT |
ATP-dependent Clp protease proteolytic subunit, putative |
at |
CANINE_2:CFA.16056.1.S1_AT |
similar to Putative ATP-dependent Clp protease proteolytic subunit, mitochondrial precursor (Endopeptidase Clp) |
cfa |
CANINE_2:CFAAFFX.28567.1.S1_AT |
similar to Putative ATP-dependent Clp protease proteolytic subunit, mitochondrial precursor (Endopeptidase Clp) |
cfa |
CANINE_2:CFAAFFX.28567.1.S1_S_AT |
similar to Putative ATP-dependent Clp protease proteolytic subunit, mitochondrial precursor (Endopeptidase Clp) |
cfa |
DROSOPHILA_2:1633579_AT |
|
dm |
DROSGENOME1:152331_AT |
|
dm |
HG-U133_PLUS_2:202799_AT |
ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) |
hs |
HG-U133A:202799_AT |
ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) |
hs |
HG-FOCUS:202799_AT |
ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) |
hs |
HG-U133A_2:202799_AT |
ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) |
hs |
HUGENEFL:Z50853_AT |
ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) |
hs |
U133_X3P:G5174418_3P_AT |
ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) |
hs |
HG-U95AV2:32528_AT |
ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) |
hs |
MU11KSUBA:AA274721_S_AT |
caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) |
mm |
MU11KSUBB:MSA.3830.0_S_AT |
caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) |
mm |
MG-U74AV2:93048_AT |
caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) |
mm |
MOE430A:1416615_AT |
caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) |
mm |
MOUSE430A_2:1416615_AT |
caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) |
mm |
MOUSE430_2:1416615_AT |
caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) |
mm |
MOE430A:1416616_S_AT |
caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) |
mm |
MOUSE430A_2:1416616_S_AT |
caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) |
mm |
MOUSE430_2:1416616_S_AT |
caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli) |
mm |
MU19KSUBA:TC18675_AT |
Caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli), mRNA (cDNA clone MGC:5755 IMAGE:3487489) |
mm |
RG-U34B:RC_AI031012_AT |
similar to ClpP protease |
rn |
RAE230A:1371789_AT |
similar to ClpP protease |
rn |
RAT230_2:1371789_AT |
similar to ClpP protease |
rn | |
|
|
|
|
|
6508 |
proteolysis |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
8462 |
endopeptidase Clp activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAA88886 |
Hypothetical protein ZK970.2 [Caenorhabditis elegans] ref|NP_496215.1| ZK970.2 [Caenorhabditis elegans] sp|Q27539|CLPP_CAEEL Probable ClpP-like protease (Endopeptidase Clp) |
1.0E-113 |
blast |
CAA88886 |
Hypothetical protein ZK970.2 [Caenorhabditis elegans] ref|NP_496215.1| ZK970.2 [Caenorhabditis elegans] sp|Q27539|CLPP_CAEEL Probable ClpP-like protease (Endopeptidase Clp) |
1.0E-108 |
blast |
CAE57828 |
Hypothetical protein CBG00853 [Caenorhabditis briggsae] |
1.0E-104 |
blast |
CAE57828 |
Hypothetical protein CBG00853 [Caenorhabditis briggsae] |
1.0E-101 |
blast |
CAG05962 |
unnamed protein product [Tetraodon nigroviridis] |
3.0E-68 |
blast |
CAA88886 |
Hypothetical protein ZK970.2 [Caenorhabditis elegans] ref|NP_496215.1| ZK970.2 [Caenorhabditis elegans] sp|Q27539|CLPP_CAEEL Probable ClpP-like protease (Endopeptidase Clp) |
7.0E-35 | |
|
|
|
|
|
Pfam |
IPR001907 EMBL-EBI |
Peptidase S14, ClpP |
5.2E-119 |
Pfam |
IPR001907 EMBL-EBI |
Peptidase S14, ClpP |
5.5E-31 |
Pfam |
IPR001907 EMBL-EBI |
Peptidase S14, ClpP |
3.9E-39 |
Pfam |
IPR001907 EMBL-EBI |
Peptidase S14, ClpP |
5.2E-119 | |
Sequence |
|
>C. ELEGANS:190263_AT
gttcaatcacgcgttggaattccatttgtaatcgataatgaaggaaaaggagaacgtaca
tatgatatttactcgagacttcttcgcgatcgaatcgtttgtcttatgacaccggtagat
gatttcattgcttctgcacttatcgcacaactcttgtttcttcaaagcgaaagtggcaaa
aaaccaattcacatgtatattaacagtccaggcggcagtgtaacagcaggacttgctatt
tatgacacaatacaaatgataagtgcaccagtgtccacatgggtgatcggacaagcatca
tcaatgggatcactgctgctttgtgccggtgaaaaaggaatgcgaagtgctctcccga
BLASTn GenBank NR |
|
|
|
|
|
|
GTTCAATCACGCGTTGGAATTCCAT |
437 |
445 |
25 |
Antisense |
TTTACTCGAGACTTCTTCGCGATCG |
591 |
673 |
92 |
Antisense |
GCGATCGAATCGTTTGTCTTATGAC |
135 |
291 |
110 |
Antisense |
GATTTCATTGCTTCTGCACTTATCG |
136 |
429 |
145 |
Antisense |
GCACTTATCGCACAACTCTTGTTTC |
611 |
315 |
160 |
Antisense |
GTATATTAACAGTCCAGGCGGCAGT |
46 |
453 |
219 |
Antisense |
GCGGCAGTGTAACAGCAGGACTTGC |
153 |
293 |
236 |
Antisense |
TAAGTGCACCAGTGTCCACATGGGT |
241 |
637 |
284 |
Antisense |
GCATCATCAATGGGATCACTGCTGC |
348 |
309 |
319 |
Antisense |
TCACTGCTGCTTTGTGCCGGTGAAA |
79 |
621 |
334 |
Antisense |
AAAGGAATGCGAAGTGCTCTCCCGA |
364 |
121 |
358 |
Antisense | |
|
Affymetrix Proprietary Database |