[Home] | [Total List]

[190070_at] amino acid permease

Description F23F1.6 /REP_DB=WormBase Gene ID /WP=CE09606 /TR=O17069 /GB=AAB70324.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=amino acid permease
Cluster 6grp_high1_10_10 > 99      6grp_total > 99      4grp_total > 04      6grp_total_sub > Increase      6grp_rule_based > S5      

Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 294
1 2 3 4 range
A 160.8
(-1.7)
P 		101.5
(-3)
A 		108.3
(-2.8)
A 		371.2
(3)
P 		270
B 145.1
(-0.8)
A 		128.1
(-1.4)
A 		77
(-3)
A 		263.7
(3)
P 		187
C 172.2
(-0.7)
P 		81.1
(-3)
A 		102.3
(-2.5)
A 		319.4
(3)
P 		238
avr 159.4
(-1.3) 		103.6
(-2.8) 		95.9
(-3) 		318.1
(3) 		222

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 313
1 2 3 4 5 6 range
A 198.1
(-2.3)
M 		161.2
(-3)
P 		258.2
(-1.1)
P 		228.3
(-1.7)
P 		464.1
(3)
P 		298.8
(-0.3)
P 		303
B 228.2
(-2.3)
P 		203.4
(-3)
P 		232.8
(-2.2)
P 		235.5
(-2.1)
P 		371.8
(1.6)
P 		421.4
(3)
P 		218
C 150.9
(-3)
P 		215.5
(-1.6)
P 		212
(-1.7)
P 		258.6
(-0.6)
P 		317.8
(0.7)
P 		423.7
(3)
P 		273
avr 192.4
(-3) 		193.4
(-3) 		234.3
(-1.7) 		240.8
(-1.5) 		384.6
(3) 		381.3
(2.9) 		192
No Scale
G range Absolute graph Relative graph Expression Table Dauer Comp.
4 41
1 2 3 4 range
A 58.6
(3)
P 		22
(-3)
A 		28.3
(-2)
A 		54.3
(2.3)
P 		37
B 46.3
(1.5)
A 		31.6
(-0.8)
A 		17.8
(-3)
A 		56.2
(3)
P 		38
C 57
(3)
P 		23.3
(-3)
A 		35.7
(-0.8)
A 		53.9
(2.4)
P 		34
avr 54
(2.8) 		25.6
(-3) 		27.3
(-2.7) 		54.8
(3) 		29

1 : 1 state (S1, L1)
2 : dauer (ST, LT)
6 121
1 2 3 4 5 6 range
A 36.5
(-3)
M 		57.3
(-1.8)
P 		56.2
(-1.9)
P 		57.9
(-1.8)
P 		140
(3)
P 		72.8
(-0.9)
P 		104
B 79.4
(-1.6)
P 		67.7
(-2.3)
P 		56.5
(-3)
P 		62.4
(-2.6)
P 		151
(2.6)
P 		157.1
(3)
P 		101
C 55.9
(-2.7)
P 		65.7
(-2.1)
P 		54
(-2.9)
P 		52
(-3)
P 		102.8
(0.4)
P 		141.8
(3)
P 		90
avr 57.3
(-2.9) 		63.6
(-2.4) 		55.6
(-3) 		57.4
(-2.9) 		131.3
(3) 		123.9
(2.4) 		76
NetAffx Links Cluster Members
Consensus/Exemplar
GeneChip Array Information
Probe Set ID 190070_at
GeneChip Array C. elegans Genome Array
Organism Common Name Nematode
Probe Design Information
Transcript ID(Array Design) affy.Ce.5354
Sequence Type Exemplar sequence
Representative Public ID F23F1.6 NCBI
Target Description F23F1.6 /REP_DB=WormBase Gene ID /WP=CE09606 /TR=O17069 /GB=AAB70324.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=amino acid permease
Cluster Evidence This cluster is supported by a Sanger Annotation.
Annotation Method Description
Annotation Description This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s).
Annotation Grade This is a grade A annotation.
Annotation Transcript Cluster (# of Matching Probes) NM_061241(11)
Transcript Assignments
Representative
Transcript		 Description Matching Probes Related Probesets by Grade
NM_061241 NCBI Caenorhabditis elegans F23F1.6 (F23F1.6) mRNA, complete cds. 11/11 None
GENEFINDER00000004434 ENSEMBL cdna:GeneFinder chromosome:CEL140:II:35301:39487:-1 11/11 None
F23F1.6 ENSEMBL cdna:known chromosome:CEL140:II:35245:37313:-1 gene:F23F1.6 11/11 None
Annotation Notes
Cross Hybridizing mRNA Matched Probes Nature of Assignment Related Probesets by Grade
SNAP00000004424 7/11 Cross Hyb Matching Probes None
Genomic Alignment of Consensus/Exemplar Sequence
Assembly Wormbase March 2004
Alignment(s)
Position Identity Coverage Cytoband
chrII:35300-37302(-) 100.0 100.0
Public Domain and Genome References
Gene Title amino acid permease
Ensembl F23F1.6
Entrez Gene 184903 Entrez gene
SwissProt O17069 EMBL-EBI
WormBase CE09606 Wormbase
Functional Annotations
Ortholog
ID Title Organism
ATH1-121501:259337_AT amino acid permease family protein at
CANINE:1590155_AT similar to High-affinity cationic amino acid transporter-1 (CAT-1) (CAT1) (System Y+ basic amino acid transporter) (Ecotropic retroviral leukemia receptor homolog) (ERR) (Ecotropic retrovirus receptor homolog) cfa
CANINE_2:CFA.12030.1.A1_AT similar to High-affinity cationic amino acid transporter-1 (CAT-1) (CAT1) (System Y+ basic amino acid transporter) (Ecotropic retroviral leukemia receptor homolog) (ERR) (Ecotropic retrovirus receptor homolog) cfa
CANINE_2:CFAAFFX.10937.1.S1_AT similar to High-affinity cationic amino acid transporter-1 (CAT-1) (CAT1) (System Y+ basic amino acid transporter) (Ecotropic retroviral leukemia receptor homolog) (ERR) (Ecotropic retrovirus receptor homolog) cfa
CANINE_2:CFAAFFX.10940.1.S1_AT similar to High-affinity cationic amino acid transporter-1 (CAT-1) (CAT1) (System Y+ basic amino acid transporter) (Ecotropic retroviral leukemia receptor homolog) (ERR) (Ecotropic retrovirus receptor homolog) cfa
DROSGENOME1:141761_AT dm
DROSOPHILA_2:1627578_S_AT dm
CHICKEN:GGAAFFX.10939.1.S1_AT similar to High-affinity cationic amino acid transporter-1 (CAT-1) (CAT1) (System Y+ basic amino acid transporter) (Ecotropic retroviral leukemia receptor homolog) (ERR) (Ecotropic retrovirus receptor homolog) gga
CHICKEN:GGAAFFX.10939.2.S1_AT similar to High-affinity cationic amino acid transporter-1 (CAT-1) (CAT1) (System Y+ basic amino acid transporter) (Ecotropic retroviral leukemia receptor homolog) (ERR) (Ecotropic retrovirus receptor homolog) gga
HG-U133_PLUS_2:206566_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-U133A:206566_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-FOCUS:206566_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-U133A_2:206566_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HU35KSUBA:RC_AA007160_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HU35KSUBB:RC_R40431_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HUGENEFL:X57303_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
U133_X3P:G4507046_3P_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
U133_X3P:HS.14846.0.A3_3P_A_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
U133_X3P:HS.14846.0.A2_3P_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
U133_X3P:HS.14846.0.A1_3P_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-U133A_2:212290_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-U133_PLUS_2:212290_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-U133A:212290_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-U133A_2:212292_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-U133_PLUS_2:212292_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-U133A:212292_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-U133A_2:212295_S_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-U133_PLUS_2:212295_S_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-U133A:212295_S_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-U95AV2:36274_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-U95AV2:39748_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-U133_PLUS_2:215979_S_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-U133A_2:215979_S_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-U133A:215979_S_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-U133_PLUS_2:215401_AT Solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-U133A_2:215401_AT Solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-U133A:215401_AT Solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
U133_X3P:HS2.374683.1.S1_3P_X_AT Solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
U133_X3P:HS2.374683.1.S1_3P_AT Solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
U133_X3P:HS.306633.0.S1_3P_AT Solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
U133_X3P:1554971_3P_AT Solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
HG-U133_PLUS_2:1554971_AT Solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 hs
MU11KSUBA:M26687_S_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 mm
MG-U74AV2:101208_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 mm
MOE430A:1421533_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 mm
MOUSE430A_2:1421533_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 mm
MOUSE430_2:1421533_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 mm
MOE430B:1454992_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 mm
MOUSE430_2:1454992_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 mm
MG-U74BV2:110341_AT Solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 (Slc7a1), mRNA mm
MOE430B:1454991_AT Solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 (Slc7a1), mRNA mm
MOUSE430_2:1454991_AT Solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 (Slc7a1), mRNA mm
MU19KSUBC:TC40498_AT Solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 (Slc7a1), mRNA mm
RAE230A:1368391_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 rn
RAT230_2:1368391_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 rn
RG-U34A:L10152_S_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 rn
RG-U34A:U70476_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 rn
RG-U34A:RC_AA957917_S_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 rn
RAE230A:1368392_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 rn
RAT230_2:1368392_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 rn
RAE230A:1387167_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 rn
RAT230_2:1387167_AT solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 rn
Gene Ontology
GO Biological Process (view graph)
ID Description Evidence Links
6810 transport inferred from electronic annotation QuickGO AmiGO
6865 amino acid transport inferred from electronic annotation QuickGO AmiGO
GO Cellular Component (view graph)
ID Description Evidence Links
16020 membrane inferred from electronic annotation QuickGO AmiGO
16021 integral to membrane inferred from electronic annotation QuickGO AmiGO
GO Molecular Function (view graph)
ID Description Evidence Links
15359 amino acid permease activity inferred from electronic annotation QuickGO AmiGO
Protein Similarities
Method ID Description E-Value
blast AAB70324 Hypothetical protein F23F1.6 [Caenorhabditis elegans] ref|NP_493642.1| F23F1.6 [Caenorhabditis elegans] 0.0
blast CAE62828 Hypothetical protein CBG07007 [Caenorhabditis briggsae] 0.0
blast CAE72454 Hypothetical protein CBG19625 [Caenorhabditis briggsae] 0.0
Protein Domains
Database ID Description E-Value
Pfam IPR004841 EMBL-EBI Amino acid permease-associated region 2.1E-12
Pfam IPR004841 EMBL-EBI Amino acid permease-associated region 1.4E-23
Pfam IPR004841 EMBL-EBI Amino acid permease-associated region 2.1E-12
Pfam IPR004841 EMBL-EBI Amino acid permease-associated region 1.4E-23
Trans Membrane
ID Number Of Domains Domain Boundaries
NP_493642.1 14 29-51,61-83,95-117,158-180,193-212,232-254,267-289,337-359,366-384,389-411,450-472,476-498,510-532,536-555
F23F1.6 14 29-51,61-83,95-117,158-180,193-212,232-254,267-289,337-359,366-384,389-411,450-472,476-498,510-532,536-555
GENEFINDER00000004434 14 175-197,207-229,241-263,304-326,339-358,378-400,413-435,483-505,512-530,535-557,596-618,622-644,656-678,682-701
Sequence
Target Sequence 
>C. ELEGANS:190070_AT
caattttggcactggtcttcgatctgcaggcgcttgtcgactttttgtcaattggaactc
tgttggcttattcaatggtctcaatctgtgttattattttgcggcatcaatcccatcttg
tagatggtagtgcaactgattatgataatggcggatgcctgaagtcgtgggtaccatttc
aaggtgtttgggaaaatttctcagaggggatttcaattcgcgtagctgtcgcaggattaa
tttttggttatatttgcctggcaattccattcagaacaggaatatttagcaatgctggtg
gtattattttattgacagtcggtgctgccttttcactgttatcattcgtttttattttgg
gccatgaacagaataagtcaacatctacgtataaggtgccacttgttccattcattccat
gccttggtctactcatcaatgtcttcatgatggtgtatctaaactcaatgacttggattc
gtctttttgtatggttggcgattggcattgtaatctacatttgttatggtatccgtcaca
gcaaaga

BLASTn GenBank NR
Probe Info
Probe Sequence(5'-3') Probe X Probe Y Probe Interrogation
Position 		Strandedness
CAATTTTGGCACTGGTCTTCGATCT 183 179 1145 Antisense
GGAACTCTGTTGGCTTATTCAATGG 575 529 1198 Antisense
TTATTTTGCGGCATCAATCCCATCT 57 679 1238 Antisense
GATGCCTGAAGTCGTGGGTACCATT 517 413 1298 Antisense
GGGATTTCAATTCGCGTAGCTGTCG 116 497 1351 Antisense
TTTGCCTGGCAATTCCATTCAGAAC 666 667 1397 Antisense
TTATTGACAGTCGGTGCTGCCTTTT 635 677 1453 Antisense
ATAAGGTGCCACTTGTTCCATTCAT 279 25 1535 Antisense
CATGCCTTGGTCTACTCATCAATGT 690 209 1562 Antisense
GGATTCGTCTTTTTGTATGGTTGGC 125 509 1619 Antisense
GTTATGGTATCCGTCACAGCAAAGA 358 447 1667 Antisense
Sequence Source Affymetrix Proprietary Database