|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
189920_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.15730
|
|
Exemplar sequence
|
|
F44C8.5 NCBI
|
|
F44C8.5 /REP_DB=WormBase Gene ID /WP=CE10386 /TR=O16358 /GB=AAB65892.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=zinc finger protein
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq,GenBank identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001028752(11), NM_001028751(11), AY305840(11) |
|
|
|
|
|
NM_001028752 NCBI |
Caenorhabditis elegans Nuclear Hormone Receptor family member (nhr-128) (nhr-128) mRNA, complete cds. |
11/11 |
None |
NM_001028751 NCBI |
Caenorhabditis elegans Nuclear Hormone Receptor family member (nhr-128) (nhr-128) mRNA, complete cds. |
11/11 |
None |
AY305840 NCBI |
Caenorhabditis elegans clone yk818d8 nuclear receptor NHR-128 mRNA, partial cds. |
11/11 |
None |
SNAP00000011142 ENSEMBL |
cdna:SNAP chromosome:CEL140:V:2219221:2224405:1 |
11/11 |
None |
GENEFINDER00000011149 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:V:2221907:2228797:1 |
11/11 |
None |
F44C8.5b ENSEMBL |
cdna:known chromosome:CEL140:V:2221775:2225149:1 gene:F44C8.5 |
11/11 |
None |
F44C8.5a ENSEMBL |
cdna:known chromosome:CEL140:V:2221893:2225143:1 gene:F44C8.5 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrV:2221774-2224405(+) |
94.54 |
100.0 |
| |
Public Domain and Genome References |
|
F44C8.5
|
Functional Annotations |
|
|
|
|
|
blast |
AAQ62454 |
Nuclear hormone receptor family protein 128, isoform b [Caenorhabditis elegans] ref|NP_001023923.1| Nuclear Hormone Receptor family member (nhr-128) [Caenorhabditis elegans] |
0.0 |
blast |
T31792 |
hypothetical protein F44C8.3 - Caenorhabditis elegans |
0.0 |
blast |
AAK84533 |
Nuclear hormone receptor family protein 18 [Caenorhabditis elegans] ref|NP_503608.2| Nuclear Hormone Receptor family member (nhr-18) [Caenorhabditis elegans] sp|O16360|NHR18_CAEEL Nuclear hormone receptor family member nhr-18 |
0.0 |
blast |
AAD03690 |
nuclear receptor NHR-18 [Caenorhabditis elegans] pir||T43356 nuclear receptor NHR-18 - Caenorhabditis elegans (fragment) |
0.0 |
blast |
AAB65893 |
Nuclear hormone receptor family protein 56, isoform a [Caenorhabditis elegans] ref|NP_503605.3| Nuclear Hormone Receptor family member (nhr-56) [Caenorhabditis elegans] |
1.0E-164 |
blast |
AAG15152 |
nuclear receptor NHR-56 [Caenorhabditis elegans] |
1.0E-164 |
blast |
AAR11985 |
nuclear receptor NHR-128 [Caenorhabditis elegans] |
1.0E-123 |
blast |
AAQ62454 |
Nuclear hormone receptor family protein 128, isoform b [Caenorhabditis elegans] ref|NP_001023923.1| Nuclear Hormone Receptor family member (nhr-128) [Caenorhabditis elegans] |
1.0E-123 | |
|
|
|
|
|
Pfam |
IPR001628 EMBL-EBI |
Zn-finger, C4-type steroid receptor |
3.1E-17 |
Pfam |
IPR001628 EMBL-EBI |
Zn-finger, C4-type steroid receptor |
2.6E-17 |
Pfam |
IPR000536 EMBL-EBI |
Ligand-binding domain of nuclear hormone receptor |
0.0064 |
Pfam |
IPR001628 EMBL-EBI |
Zn-finger, C4-type steroid receptor |
1.7E-4 |
Pfam |
IPR000536 EMBL-EBI |
Ligand-binding domain of nuclear hormone receptor |
1.2E-5 |
Pfam |
IPR000536 EMBL-EBI |
Ligand-binding domain of nuclear hormone receptor |
6.7E-5 |
Pfam |
IPR001628 EMBL-EBI |
Zn-finger, C4-type steroid receptor |
3.1E-17 |
Pfam |
IPR001628 EMBL-EBI |
Zn-finger, C4-type steroid receptor |
1.5E-5 |
Pfam |
IPR001628 EMBL-EBI |
Zn-finger, C4-type steroid receptor |
3.4E-18 | |
Sequence |
|
>C. ELEGANS:189920_AT
tagtaaaggctgcctggatcccctggacaattttggagaagctttacgagacctctgatt
accaaaggaaaaatatttttagcaagactgtactgatgtgtggcaatgatacatgtatgg
acatgaacaactacgagctcgatttatcctggctcacggactactcgttggaccagctta
catactttttcactccaccagaagcgaacaaaaactatttaaaaggccttgaagccttaa
tcgagctgaatccaagctccattgaggtcaactacatgcttcttcaactctcactccaac
acgccgggaaaattctacttggcagtgcgcaa
BLASTn GenBank NR |
|
|
|
|
|
|
TAGTAAAGGCTGCCTGGATCCCCTG |
468 |
653 |
812 |
Antisense |
GGAGAAGCTTTACGAGACCTCTGAT |
104 |
519 |
846 |
Antisense |
GGACATGAACAACTACGAGCTCGAT |
415 |
525 |
930 |
Antisense |
CGAGCTCGATTTATCCTGGCTCACG |
656 |
249 |
945 |
Antisense |
GACTACTCGTTGGACCAGCTTACAT |
655 |
371 |
970 |
Antisense |
GGACCAGCTTACATACTTTTTCACT |
154 |
523 |
981 |
Antisense |
TTTTTCACTCCACCAGAAGCGAACA |
139 |
675 |
997 |
Antisense |
GGCCTTGAAGCCTTAATCGAGCTGA |
423 |
543 |
1036 |
Antisense |
GCTGAATCCAAGCTCCATTGAGGTC |
194 |
293 |
1056 |
Antisense |
CTCACTCCAACACGCCGGGAAAATT |
700 |
223 |
1101 |
Antisense |
GAAAATTCTACTTGGCAGTGCGCAA |
35 |
353 |
1119 |
Antisense | |
|
Affymetrix Proprietary Database |