|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
189900_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.4703
|
|
Exemplar sequence
|
|
B0454.6 NCBI
|
|
B0454.6 /REP_DB=WormBase Gene ID /WP=CE07756 /TR=O17167 /GB=AAB70943.1 /SUBMIT=ST.LOUIS /CHR=2 /FEA=Sanger Annotation /DEF=amino acid permease
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_062027(11) |
|
|
|
|
|
NM_062027 NCBI |
Caenorhabditis elegans B0454.6 (B0454.6) mRNA, complete cds. |
11/11 |
None |
SNAP00000034447 ENSEMBL |
cdna:SNAP chromosome:CEL140:II:3032779:3035903:1 |
11/11 |
None |
GENEFINDER00000034460 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:II:3032779:3035903:1 |
11/11 |
None |
B0454.6 ENSEMBL |
cdna:known chromosome:CEL140:II:3032775:3036119:1 gene:B0454.6 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrII:3032777-3035902(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
amino acid permease
|
|
B0454.6
|
|
173650 Entrez gene
|
|
O17167 EMBL-EBI
|
|
CE07756 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:245868_AT |
amino acid permease family protein |
at |
CANINE_2:CFAAFFX.11308.1.S1_S_AT |
similar to solute carrier family 7, member 2 isoform 1 |
cfa |
CANINE_2:CFAAFFX.11313.1.S1_AT |
similar to solute carrier family 7, member 2 isoform 1 |
cfa |
DROSOPHILA_2:1627343_A_AT |
|
dm |
DROSGENOME1:152169_AT |
|
dm |
CHICKEN:GGA.10093.1.S1_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
gga |
CHICKEN:GGAAFFX.8684.1.S1_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
gga |
HG-U133_PLUS_2:207626_S_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
hs |
HG-U133A:207626_S_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
hs |
HG-FOCUS:207626_S_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
hs |
HG-U133A_2:207626_S_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
hs |
HU35KSUBC:RC_AA456311_S_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
hs |
HU35KSUBD:RC_AA419608_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
hs |
HUGENEFL:U76369_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
hs |
U133_X3P:G4507048_3P_A_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
hs |
U133_X3P:HS.93961.0.A1_3P_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
hs |
HG-U133_PLUS_2:225516_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
hs |
HG-U133B:225516_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
hs |
HG-U95AV2:38169_S_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
hs |
HG-U95AV2:40236_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
hs |
HG-U95B:46699_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
hs |
HG-U95C:60779_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
hs |
HG-U133_PLUS_2:230658_AT |
Solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
hs |
HG-U133B:230658_AT |
Solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
hs |
U133_X3P:HS.153985.1.A1_3P_AT |
Solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
hs |
MOE430A:1422648_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
mm |
MOUSE430A_2:1422648_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
mm |
MOUSE430_2:1422648_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
mm |
MOE430A:1426008_A_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
mm |
MOUSE430_2:1426008_A_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
mm |
MOUSE430A_2:1426008_A_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
mm |
MG-U74AV2:92736_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
mm |
MU11KSUBA:L29006_S_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
mm |
MOE430A:1450703_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
mm |
MOUSE430A_2:1450703_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
mm |
MOUSE430_2:1450703_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
mm |
MG-U74BV2:110182_AT |
Solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 (Slc7a2), mRNA |
mm |
MOE430B:1440506_AT |
Solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 (Slc7a2), mRNA |
mm |
MOUSE430_2:1440506_AT |
Solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 (Slc7a2), mRNA |
mm |
MU19KSUBC:TC41065_S_AT |
Solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 (Slc7a2), mRNA |
mm |
RN-U34:U53927_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
rn |
RG-U34A:U53927_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
rn |
RAE230A:1369460_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
rn |
RAT230_2:1369460_AT |
solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 |
rn | |
|
|
|
|
|
6810 |
transport |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
16020 |
membrane |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
AAB70943 |
Hypothetical protein B0454.6 [Caenorhabditis elegans] ref|NP_494428.1| B0454.6 [Caenorhabditis elegans] |
0.0 |
blast |
CAE72454 |
Hypothetical protein CBG19625 [Caenorhabditis briggsae] |
0.0 |
blast |
AAB70324 |
Hypothetical protein F23F1.6 [Caenorhabditis elegans] ref|NP_493642.1| F23F1.6 [Caenorhabditis elegans] |
0.0 | |
|
|
|
|
|
Pfam |
IPR004841 EMBL-EBI |
Amino acid permease-associated region |
7.6E-11 |
Pfam |
IPR004841 EMBL-EBI |
Amino acid permease-associated region |
1.4E-20 |
NP_494428.1 |
14 |
36-55,59-81,94-116,158-180,192-211,226-248,268-290,316-338,364-383,388-410,443-465,475-497,509-531,535-554 |
B0454.6 |
14 |
36-55,59-81,94-116,158-180,192-211,226-248,268-290,316-338,364-383,388-410,443-465,475-497,509-531,535-554 |
SNAP00000034447 |
14 |
36-55,59-81,94-116,158-180,192-211,226-248,268-290,316-338,364-383,388-410,443-465,475-497,509-531,535-554 |
GENEFINDER00000034460 |
14 |
36-55,59-81,94-116,158-180,192-211,226-248,268-290,316-338,364-383,388-410,443-465,475-497,509-531,535-554 | |
Sequence |
|
>C. ELEGANS:189900_AT
gagagctgagctcatggattcctgctcgaaacttctgggagtctttacccgccggcacct
cgatttccctgggtgtcgccgcgttgatcggctcatttttctggttggcattcacttttc
ggactggattttatgagcattggtatggtcaaatatcgattggtttcaatggattattga
ttgttttggtgatggcttttattctcggacaccagcagaactcactggaaactagcttca
aggttccatttgtcccattccttccgtgtctatccctcctagtcaatgtattcatgatgg
cctacttgacaactgccacatggatccggctttttgtctggatgggtgttggcctcttga
tctacttttcctatggaatccgacattccaaagaagccaagaagctcaccacaattgccg
at
BLASTn GenBank NR |
|
|
|
|
|
|
GAGAGCTGAGCTCATGGATTCCTGC |
63 |
393 |
1295 |
Antisense |
GATTCCTGCTCGAAACTTCTGGGAG |
642 |
431 |
1311 |
Antisense |
TGATCGGCTCATTTTTCTGGTTGGC |
19 |
565 |
1379 |
Antisense |
TCTGGTTGGCATTCACTTTTCGGAC |
618 |
607 |
1394 |
Antisense |
TGGTGATGGCTTTTATTCTCGGACA |
255 |
553 |
1481 |
Antisense |
ATTCTCGGACACCAGCAGAACTCAC |
123 |
11 |
1495 |
Antisense |
TATCCCTCCTAGTCAATGTATTCAT |
328 |
659 |
1565 |
Antisense |
GATGGCCTACTTGACAACTGCCACA |
193 |
407 |
1590 |
Antisense |
AACTGCCACATGGATCCGGCTTTTT |
660 |
141 |
1605 |
Antisense |
CCTCTTGATCTACTTTTCCTATGGA |
125 |
269 |
1647 |
Antisense |
CAAGAAGCTCACCACAATTGCCGAT |
369 |
185 |
1692 |
Antisense | |
|
Affymetrix Proprietary Database | |