|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
189671_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.15028
|
|
Exemplar sequence
|
|
C50H11.15 NCBI
|
|
C50H11.15 /REP_DB=WormBase Gene ID /WP=CE08931 /TR=O16482 /GB=AAG24002.1 /SUBMIT=ST.LOUIS /CHR=5 /FEA=Sanger Annotation /DEF=cytochrome P450
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_071445(11) |
|
|
|
|
|
NM_071445 NCBI |
Caenorhabditis elegans CYtochrome P450 family member (cyp-33C9) (cyp-33C9) mRNA, complete cds. |
11/11 |
None |
SNAP00000043570 ENSEMBL |
cdna:SNAP chromosome:CEL140:V:3091686:3095423:-1 |
11/11 |
None |
C50H11.15 ENSEMBL |
cdna:known chromosome:CEL140:V:3091673:3094328:-1 gene:C50H11.15 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrV:3091685-3094310(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
cytochrome P450
|
|
cyp-33C9
|
|
C50H11.15
|
|
178752 Entrez gene
|
|
O16482 EMBL-EBI
|
|
CE08931 Wormbase
|
Functional Annotations |
|
|
|
|
ATH1-121501:261986_S_AT |
cytochrome P450, putative |
at |
HG-U95AV2:1552_I_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
HC-G110:1552_I_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
HG-U95AV2:1553_R_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
HC-G110:1553_R_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
HG-U133_PLUS_2:208327_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
HG-U133A:208327_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
HG-FOCUS:208327_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
HG-U133A_2:208327_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
HG-U95AV2:1554_F_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
HC-G110:1554_F_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
HG-U133_PLUS_2:207718_X_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
HG-U133A:207718_X_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
HG-FOCUS:207718_X_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
HG-U133A_2:207718_X_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
HG-U95AV2:1338_S_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
HC-G110:1338_S_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
HUGENEFL:U22028_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
HUGENEFL:U22028_R_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
U133_X3P:G6470138_3P_S_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
U133_X3P:G13699808_3P_X_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
U133_X3P:G13699808_3P_S_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
U133_X3P:G13699808_3P_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
U133_X3P:208327_3P_AT |
cytochrome P450, family 2, subfamily A, polypeptide 13 |
hs |
MOUSE430_2:1422230_S_AT |
cytochrome P450, family 2, subfamily a, polypeptide 4 |
mm |
MOE430A:1422230_S_AT |
cytochrome P450, family 2, subfamily a, polypeptide 4 |
mm |
MOUSE430A_2:1422230_S_AT |
cytochrome P450, family 2, subfamily a, polypeptide 4 |
mm |
MU11KSUBA:J03549_S_AT |
cytochrome P450, family 2, subfamily a, polypeptide 4 |
mm |
MG-U74AV2:102847_S_AT |
cytochrome P450, family 2, subfamily a, polypeptide 4 |
mm |
MOUSE430_2:1422230_S_AT |
cytochrome P450, family 2, subfamily a, polypeptide 5 |
mm |
MOE430A:1422230_S_AT |
cytochrome P450, family 2, subfamily a, polypeptide 5 |
mm |
MOUSE430A_2:1422230_S_AT |
cytochrome P450, family 2, subfamily a, polypeptide 5 |
mm |
MU11KSUBA:J03549_S_AT |
cytochrome P450, family 2, subfamily a, polypeptide 5 |
mm |
MG-U74AV2:102847_S_AT |
cytochrome P450, family 2, subfamily a, polypeptide 5 |
mm |
RT-U34:J02852_G_AT |
Cytochrome P450, subfamily IIA (phenobarbital-inducble)/ (Cytochrome P450 IIA3) |
rn |
RG-U34A:J02852_G_AT |
Cytochrome P450, subfamily IIA (phenobarbital-inducble)/ (Cytochrome P450 IIA3) |
rn |
RT-U34:J02852_AT |
Cytochrome P450, subfamily IIA (phenobarbital-inducble)/ (Cytochrome P450 IIA3) |
rn |
RG-U34A:J02852_AT |
Cytochrome P450, subfamily IIA (phenobarbital-inducble)/ (Cytochrome P450 IIA3) |
rn |
RAE230A:1369136_AT |
Cytochrome P450, subfamily IIA (phenobarbital-inducble)/ (Cytochrome P450 IIA3) |
rn |
RAT230_2:1369136_AT |
Cytochrome P450, subfamily IIA (phenobarbital-inducble)/ (Cytochrome P450 IIA3) |
rn | |
|
|
|
|
|
6118 |
electron transport |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
4497 |
monooxygenase activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
NP_503846 |
CYtochrome P450 family member (cyp-33C9) [Caenorhabditis elegans] gb|AAG24002.1| Cytochrome p450 family protein 33C9 [Caenorhabditis elegans] |
0.0 |
blast |
CAE71568 |
Hypothetical protein CBG18519 [Caenorhabditis briggsae] |
0.0 |
blast |
CAE58152 |
Hypothetical protein CBG01242 [Caenorhabditis briggsae] |
1.0E-162 |
blast |
CAE58152 |
Hypothetical protein CBG01242 [Caenorhabditis briggsae] |
1.0E-157 | |
|
|
|
|
|
p450 |
CP1B_MOUSE |
Animalia; CYP1B-1; mou; CP1B_MOUSE; Mus musculus; Q64429 |
1.0E-156 |
p450 |
CP1B_MOUSE |
Animalia; CYP1B-1; mou; CP1B_MOUSE; Mus musculus; Q64429 |
1.0E-152 | |
|
|
|
|
|
Pfam |
IPR001128 EMBL-EBI |
Cytochrome P450 |
8.5E-116 |
Pfam |
IPR001128 EMBL-EBI |
Cytochrome P450 |
7.2E-112 |
NP_503846.1 |
1 |
2-20 |
C50H11.15 |
1 |
2-20 |
SNAP00000043570 |
2 |
15-37,64-86 | |
Sequence |
|
>C. ELEGANS:189671_AT
aacagctgtccaacatgtgtctcgatctctggtttgctgctctgatgaccacctcaaata
cgatgacatggtgctttgcctacaccctaaactacctggatgctcaacaaaaactccatg
aagaactcgatcgagtgatcggaagcgagcgacacatcaacactgctgacaagcctaatc
taccgtacaccaacgcgtacatcaacgagatccagcgaaccgccaacttggtacccttga
atcttcttcacatgacgaccagggatactgtactgaaggggtacaatattccaaagggta
ctggagtggtggcacagataagtacagttatgtatgatgagaatgtcttccctgagccgt
atattttcaagccggagagattccttgatgacgatggaaaactgaaaaaggtcgagcaac
tggtcccattttcagttggaaaacggcagtgcctcggagaagggcttgctcgtatggagc
tcttcctttttattgccaactttttcaatagatacagggttgttccggatgcaaacgggc
ctccaattatt
BLASTn GenBank NR |
|
|
|
|
|
|
AACAGCTGTCCAACATGTGTCTCGA |
231 |
137 |
878 |
Antisense |
TCTCTGGTTTGCTGCTCTGATGACC |
378 |
611 |
903 |
Antisense |
ACGATGACATGGTGCTTTGCCTACA |
694 |
93 |
937 |
Antisense |
TACACCCTAAACTACCTGGATGCTC |
491 |
641 |
958 |
Antisense |
GAAGCGAGCGACACATCAACACTGC |
259 |
343 |
1019 |
Antisense |
CTGACAAGCCTAATCTACCGTACAC |
160 |
239 |
1043 |
Antisense |
CAACTTGGTACCCTTGAATCTTCTT |
553 |
187 |
1101 |
Antisense |
GAATCTTCTTCACATGACGACCAGG |
396 |
327 |
1116 |
Antisense |
AAAAAGGTCGAGCAACTGGTCCCAT |
32 |
3 |
1282 |
Antisense |
AGGGCTTGCTCGTATGGAGCTCTTC |
607 |
57 |
1338 |
Antisense |
GGATGCAAACGGGCCTCCAATTATT |
17 |
511 |
1404 |
Antisense | |
|
Affymetrix Proprietary Database | |