|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
189311_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.7553
|
|
Exemplar sequence
|
|
H19M22.2 NCBI
|
|
H19M22.2 /REP_DB=WormBase Gene ID /WP=CE26469 /CHR=3 /FEA=Sanger Annotation /DEF=locus:let-805 (ST.LOUIS) TR:O44838 protein_id:AAB94998.1
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_001027469(11), NM_001027470(11) |
|
|
|
|
|
NM_001027469 NCBI |
Caenorhabditis elegans LEThal family member (let-805) (let-805) mRNA, complete cds. |
11/11 |
None |
NM_001027470 NCBI |
Caenorhabditis elegans LEThal family member (let-805) (let-805) mRNA, complete cds. |
11/11 |
None |
H19M22.2b.2 ENSEMBL |
cdna:known chromosome:CEL140:III:2658071:2681093:1 gene:H19M22.2 |
11/11 |
None |
H19M22.2a ENSEMBL |
cdna:known chromosome:CEL140:III:2658073:2681101:1 gene:H19M22.2 |
11/11 |
A |
H19M22.2b.1 ENSEMBL |
cdna:known chromosome:CEL140:III:2658073:2681101:1 gene:H19M22.2 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
|
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIII:2658085-2670256(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
H19M22.2
|
Functional Annotations |
|
|
|
|
|
blast |
AAK21414 |
Lethal protein 805, isoform a [Caenorhabditis elegans] ref|NP_001022640.1| LEThal family member (let-805) [Caenorhabditis elegans] gb|AAD37411.1| myotactin form A [Caenorhabditis elegans] |
0.0 |
blast |
AAK21413 |
Lethal protein 805, isoform b [Caenorhabditis elegans] ref|NP_001022641.1| LEThal family member (let-805) [Caenorhabditis elegans] gb|AAD37410.1| myotactin form B [Caenorhabditis elegans] |
0.0 |
blast |
AAO91708 |
Lethal protein 805, isoform d [Caenorhabditis elegans] ref|NP_001022643.1| LEThal family member (let-805) [Caenorhabditis elegans] |
0.0 | |
|
|
|
|
|
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
4.6E-5 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.9E-9 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.6E-10 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
4.9E-10 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.9E-6 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
2.4E-22 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
8.6E-17 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
5.9E-6 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
9.8E-14 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
6.5E-5 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
2.0E-9 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
4.0E-15 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
4.0E-15 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
9.5E-10 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.9E-16 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.6E-6 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
3.4E-7 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
2.3E-20 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
2.8E-18 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.4E-12 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
5.2E-8 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
3.1E-14 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
2.5E-13 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
3.4E-6 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
7.0E-10 |
Pfam |
IPR003961 EMBL-EBI |
Fibronectin, type III |
1.0E-8 |
NP_001022640.1 |
2 |
7-29,3909-3931 |
NP_001022641.1 |
2 |
7-29,3906-3928 |
H19M22.2b.2 |
2 |
7-29,3906-3928 |
H19M22.2a |
2 |
7-29,3909-3931 |
H19M22.2b.1 |
2 |
7-29,3906-3928 | |
Sequence |
|
>C. ELEGANS:189311_S_AT
aatacttcggatcttcgtgtcactatcgatggattgaccccatacaccaagtatgtgatg
agagttaaggcctacaactcgattggtggaggaccaaacactgagaatctcgttgtcatg
accgccaaggctcaagccccacttccaccacaggatcttgtagttgctcaagaaggaacc
agcttcttcatggtatcctggcttccaccatacccaccatacggcccacacgatgcttac
aagatccgctatcaacagatcccatcggacgattggaaggaggtggagaaaggaatcaag
gatccacttcttcagtgcccaggagaaagtccgagattctgttacaacgcaactggattg
gattcagggcaacagttcaagattcaagttgcgacaagaattgagggaggaagctacgga
ccatggtcatcgttggtgattgctaacacgcttcaa
BLASTn GenBank NR |
|
|
|
|
|
|
AATACTTCGGATCTTCGTGTCACTA |
185 |
173 |
6250 |
Antisense |
GATGGATTGACCCCATACACCAAGT |
642 |
407 |
6277 |
Antisense |
TAAGGCCTACAACTCGATTGGTGGA |
108 |
635 |
6315 |
Antisense |
TGAGAATCTCGTTGTCATGACCGCC |
483 |
569 |
6351 |
Antisense |
TGTCATGACCGCCAAGGCTCAAGCC |
187 |
559 |
6363 |
Antisense |
CCACTTCCACCACAGGATCTTGTAG |
494 |
273 |
6388 |
Antisense |
CAGCTTCTTCATGGTATCCTGGCTT |
46 |
205 |
6429 |
Antisense |
GGCCCACACGATGCTTACAAGATCC |
132 |
543 |
6472 |
Antisense |
AGATCCGCTATCAACAGATCCCATC |
294 |
67 |
6491 |
Antisense |
GGAGGAAGCTACGGACCATGGTCAT |
541 |
515 |
6655 |
Antisense |
GTTGGTGATTGCTAACACGCTTCAA |
484 |
435 |
6681 |
Antisense | |
|
Affymetrix Proprietary Database |