|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
189302_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.2341
|
|
Exemplar sequence
|
|
F46F11.5 NCBI
|
|
F46F11.5 /REP_DB=WormBase Gene ID /WP=CE10604 /GB=AAK21386.1 /SUBMIT=ST.LOUIS /CHR=1 /FEA=Sanger Annotation /DEF=vacuolar ATPase G subunit
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_059240(11) |
|
|
|
|
|
NM_059240 NCBI |
Caenorhabditis elegans Vacuolar H ATPase family member (vha-10) (vha-10) mRNA, complete cds. |
11/11 |
None |
SNAP00000023446 ENSEMBL |
cdna:SNAP chromosome:CEL140:I:5609591:5610257:-1 |
11/11 |
None |
GENEFINDER00000023463 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:I:5609591:5616383:-1 |
11/11 |
None |
F46F11.5.3 ENSEMBL |
cdna:known chromosome:CEL140:I:5609313:5610741:-1 gene:F46F11.5 |
11/11 |
None |
F46F11.5.2 ENSEMBL |
cdna:known chromosome:CEL140:I:5609313:5610279:-1 gene:F46F11.5 |
11/11 |
None |
F46F11.5.1 ENSEMBL |
cdna:known chromosome:CEL140:I:5609313:5610273:-1 gene:F46F11.5 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrI:5609590-5610257(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
vacuolar ATPase G subunit
|
|
vha-10
|
|
F46F11.5
|
|
172216 Entrez gene
|
|
P91303 EMBL-EBI
|
|
CE10604 Wormbase
|
Functional Annotations |
|
|
|
|
CANINE_2:CFA.10969.1.S1_AT |
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 2 |
cfa |
CANINE_2:CFA.10969.1.S1_S_AT |
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 2 |
cfa |
CANINE_2:CFA.10969.1.S2_AT |
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 2 |
cfa |
CANINE:1587041_AT |
ATPase, H+ transporting, V1 subunit G |
cfa |
U133_X3P:HS.249227.0.S1_3P_AT |
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 2 |
hs |
HG-U133A_2:214762_AT |
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 2 |
hs |
HG-U133_PLUS_2:214762_AT |
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 2 |
hs |
HG-U133A:214762_AT |
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 2 |
hs |
HG-U95AV2:33033_AT |
ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 2 |
hs |
MG-U74BV2:111904_AT |
ATPase, H+ transporting, V1 subunit G isoform 2 |
mm |
MOE430A:1417799_AT |
ATPase, H+ transporting, V1 subunit G isoform 2 |
mm |
MOUSE430A_2:1417799_AT |
ATPase, H+ transporting, V1 subunit G isoform 2 |
mm |
MOUSE430_2:1417799_AT |
ATPase, H+ transporting, V1 subunit G isoform 2 |
mm |
MU19KSUBA:TC19200_AT |
Atp6g2 mRNA for G2 isoform of V-ATPase subunit |
mm |
RAE230B:1377722_AT |
ATPase, H+ transporting, V1 subunit G isoform 2 |
rn |
RAT230_2:1377722_AT |
ATPase, H+ transporting, V1 subunit G isoform 2 |
rn | |
|
|
|
|
|
blast |
AAM15574 |
Hypothetical protein F46F11.9a [Caenorhabditis elegans] ref|NP_491643.2| F46F11.9a [Caenorhabditis elegans] |
0.0 |
blast |
AAM15575 |
Hypothetical protein F46F11.9b [Caenorhabditis elegans] ref|NP_491642.2| F46F11.9b [Caenorhabditis elegans] |
0.0 |
blast |
CAE68923 |
Hypothetical protein CBG14902 [Caenorhabditis briggsae] |
0.0 |
blast |
AAK21386 |
Vacuolar h atpase protein 10 [Caenorhabditis elegans] ref|NP_491641.1| Vacuolar H ATPase family member (vha-10) [Caenorhabditis elegans] sp|P91303|VATG_CAEEL Probable Vacuolar ATP synthase subunit G (V-ATPase G subunit) (Vacuolar proton pump G subunit) (V-ATPase 13 kDa subunit) |
5.0E-64 |
blast |
CAE68925 |
Hypothetical protein CBG14904 [Caenorhabditis briggsae] |
6.0E-62 | |
|
|
|
|
|
scop |
a.2.7.Seryl-tRNA synthetase (SerRS) |
All alpha proteins; Long alpha-hairpin; tRNA-binding arm; Seryl-tRNA synthetase (SerRS) |
1.39999997615814 |
Pfam |
IPR005124 EMBL-EBI |
Vacuolar (H+)-ATPase G subunit |
1.3E-56 |
Pfam |
IPR005124 EMBL-EBI |
Vacuolar (H+)-ATPase G subunit |
1.3E-56 | |
Sequence |
|
>C. ELEGANS:189302_S_AT
atggcctcacaaacccagggaattcagcaacttttggccgctgagaaacgtgccgctgag
aagatcaacgaagctcgtaagagaaagttgcagagaacgaagcaggccaagcaagaggct
caagctgaggtggagaagtacaagcagcaacgcgaggcagagttcaaggcatttgaacaa
caatacttgggaaccaaagaagatattgagagcaagattcgtcgtgatactgaggatcaa
atcagtggaatgaagcaatctgtggctggaaacaagcaagctgtcattgtccgtctcctt
caactcgtttgcgacatcaagccagagctccatcataacttgactctcc
BLASTn GenBank NR |
|
|
|
|
|
|
ATGGCCTCACAAACCCAGGGAATTC |
385 |
53 |
13 |
Antisense |
GGGAATTCAGCAACTTTTGGCCGCT |
665 |
493 |
30 |
Antisense |
TTTGGCCGCTGAGAAACGTGCCGCT |
259 |
659 |
45 |
Antisense |
GAAACGTGCCGCTGAGAAGATCAAC |
112 |
359 |
57 |
Antisense |
GCAGAGAACGAAGCAGGCCAAGCAA |
370 |
313 |
102 |
Antisense |
GAAGTACAAGCAGCAACGCGAGGCA |
374 |
335 |
147 |
Antisense |
CGCGAGGCAGAGTTCAAGGCATTTG |
469 |
255 |
163 |
Antisense |
GAGAGCAAGATTCGTCGTGATACTG |
347 |
393 |
220 |
Antisense |
GGAATGAAGCAATCTGTGGCTGGAA |
468 |
531 |
259 |
Antisense |
ACATCAAGCCAGAGCTCCATCATAA |
455 |
105 |
326 |
Antisense |
GAGCTCCATCATAACTTGACTCTCC |
661 |
387 |
337 |
Antisense | |
|
Affymetrix Proprietary Database |