|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
189175_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.9982
|
|
Exemplar sequence
|
|
C29E6.2 NCBI
|
|
C29E6.2 /REP_DB=WormBase Gene ID /WP=CE05333 /TR=Q18297 /GB=CAA96603.1 /SUBMIT=HINXTON /CHR=4 /FEA=Sanger Annotation /DEF=ankyrin repeats
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_069848(11) |
|
|
|
|
|
NM_069848 NCBI |
Caenorhabditis elegans C29E6.2 (C29E6.2) mRNA, complete cds. |
11/11 |
None |
SNAP00000002875 ENSEMBL |
cdna:SNAP chromosome:CEL140:IV:11873187:11875613:1 |
11/11 |
None |
GENEFINDER00000002886 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:IV:11869583:11875613:1 |
11/11 |
None |
C29E6.2 ENSEMBL |
cdna:known chromosome:CEL140:IV:11865011:11875684:1 gene:C29E6.2 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrIV:11865016-11875619(+) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
ankyrin repeats
|
|
trpa-1
|
|
C29E6.2
|
|
178118 Entrez gene
|
|
CE37324 Wormbase
|
Functional Annotations |
|
|
|
|
CANINE_2:CFAAFFX.12725.1.S1_AT |
similar to transient receptor potential cation channel, subfamily A, member 1 |
cfa |
DROSOPHILA_2:1639767_AT |
Transient receptor potential A1 |
dm |
DROSGENOME1:148429_AT |
Transient receptor potential A1 |
dm |
CHICKEN:GGA.18369.1.S1_AT |
transient receptor potential cation channel, subfamily A, member 1 |
gga |
CHICKEN:GGAAFFX.9959.1.S1_S_AT |
transient receptor potential cation channel, subfamily A, member 1 |
gga |
HG-U133_PLUS_2:208349_AT |
transient receptor potential cation channel, subfamily A, member 1 |
hs |
HG-U133A:208349_AT |
transient receptor potential cation channel, subfamily A, member 1 |
hs |
HG-FOCUS:208349_AT |
transient receptor potential cation channel, subfamily A, member 1 |
hs |
HG-U133A_2:208349_AT |
transient receptor potential cation channel, subfamily A, member 1 |
hs |
HG-U95AV2:33036_AT |
transient receptor potential cation channel, subfamily A, member 1 |
hs |
U133_X3P:G6601589_3P_AT |
transient receptor potential cation channel, subfamily A, member 1 |
hs |
U133_X3P:HS.326646.0.A1_3P_S_AT |
transient receptor potential cation channel, subfamily A, member 1 |
hs |
HG-U133A_2:217590_S_AT |
transient receptor potential cation channel, subfamily A, member 1 |
hs |
HG-U133_PLUS_2:217590_S_AT |
transient receptor potential cation channel, subfamily A, member 1 |
hs |
HG-U133A:217590_S_AT |
transient receptor potential cation channel, subfamily A, member 1 |
hs |
HU35KSUBC:RC_AA609561_S_AT |
Transient receptor potential cation channel, subfamily A, member 1 |
hs |
HU35KSUBD:RC_H99460_AT |
Transient receptor potential cation channel, subfamily A, member 1 |
hs |
U133_X3P:HS.108873.0.A1_3P_AT |
Transient receptor potential cation channel, subfamily A, member 1 |
hs |
HG-U133_PLUS_2:228438_AT |
Transient receptor potential cation channel, subfamily A, member 1 |
hs |
HG-U133B:228438_AT |
Transient receptor potential cation channel, subfamily A, member 1 |
hs |
HG-U95C:52309_AT |
Transient receptor potential cation channel, subfamily A, member 1 |
hs |
HG-U95C:58524_AT |
Transient receptor potential cation channel, subfamily A, member 1 |
hs |
MOE430B:1457164_AT |
transient receptor potential cation channel, subfamily A, member 1 |
mm |
MOUSE430_2:1457164_AT |
transient receptor potential cation channel, subfamily A, member 1 |
mm | |
|
|
|
|
|
6811 |
ion transport |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
16020 |
membrane |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
5216 |
ion channel activity |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAA96603 |
Hypothetical protein C29E6.2 [Caenorhabditis elegans] ref|NP_502249.2| C29E6.2 [Caenorhabditis elegans] sp|Q18297|TRPA1_CAEEL Transient receptor potential cation channel subfamily A member 1 homolog |
0.0 |
blast |
CAE62138 |
Hypothetical protein CBG06183 [Caenorhabditis briggsae] |
0.0 |
blast |
CAE62137 |
Hypothetical protein CBG06181 [Caenorhabditis briggsae] |
0.0 | |
|
|
|
|
|
Pfam |
IPR005821 EMBL-EBI |
Ion transport protein |
2.4E-20 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
2.1E-9 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
0.0015 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
2.8E-7 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
1.4E-6 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
43.0 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
6.0 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
0.021 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
2.3E-4 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
2.1E-8 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
8.0 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
2.8E-7 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
0.012 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
1.2E-8 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
0.0015 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
3.7E-4 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
0.045 |
Pfam |
IPR005821 EMBL-EBI |
Ion transport protein |
2.4E-20 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
0.82 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
0.0015 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
3.7E-4 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
0.045 |
Pfam |
IPR005821 EMBL-EBI |
Ion transport protein |
2.4E-20 |
Pfam |
IPR001888 EMBL-EBI |
Transposase, type 1 |
2.8E-41 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
0.4 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
0.0015 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
3.7E-4 |
Pfam |
IPR002110 EMBL-EBI |
Ankyrin |
0.045 |
NP_502249.2 |
5 |
795-814,878-900,915-934,955-977,1029-1051 |
C29E6.2 |
5 |
795-814,878-900,915-934,955-977,1029-1051 |
SNAP00000002875 |
5 |
273-292,356-378,393-412,433-455,507-529 |
GENEFINDER00000002886 |
3 |
701-720,741-763,815-837 | |
Sequence |
|
>C. ELEGANS:189175_AT
cttcatgtctcctctcaaaactacagtaatgatgattggagaatttgagttcactggaat
atttcacggagatgaaactactcatgctgagaaaatgtttggcccagcacacacagcagt
cgcatgtgcacttttcttctttttctgcataataatgacaattctcctgatgaatctact
tgttggtttggcagttgatgatattaaaggtgtacaagaaaaagctgaactgaaacgtct
cgcaatgcaagttgatcttgttctgcaaattgaggcctctcttcactttttcattcaacg
aaccaaaaaatatgcgacttgccgttatgcaacttttccatacggaaaacttcataagac
tggttttgccggatggtggtccaatttcagaagaagattcgggttgagtgtcagcactga
tccagaaattgacgagatgtatgaacgggaagcggagttcacttctgaaatgactcaaaa
acttcaaaaccaagcagctaaactcaaaaatattcaagaaaatattgatgtgatgtacga
gaagcaagtacgacttgaagcaatcattgcaaagctcgcgacagggctcaa
BLASTn GenBank NR |
|
|
|
|
|
|
CTTCATGTCTCCTCTCAAAACTACA |
321 |
221 |
2955 |
Antisense |
GAAAATGTTTGGCCCAGCACACACA |
648 |
353 |
3045 |
Antisense |
AGCAGTCGCATGTGCACTTTTCTTC |
621 |
77 |
3069 |
Antisense |
GATGAATCTACTTGTTGGTTTGGCA |
236 |
411 |
3123 |
Antisense |
AAGCTGAACTGAAACGTCTCGCAAT |
130 |
151 |
3176 |
Antisense |
AAATTGAGGCCTCTCTTCACTTTTT |
394 |
113 |
3221 |
Antisense |
GACTTGCCGTTATGCAACTTTTCCA |
628 |
371 |
3270 |
Antisense |
GACTGGTTTTGCCGGATGGTGGTCC |
511 |
375 |
3312 |
Antisense |
AGATTCGGGTTGAGTGTCAGCACTG |
616 |
65 |
3349 |
Antisense |
GAACGGGAAGCGGAGTTCACTTCTG |
551 |
345 |
3397 |
Antisense |
TTGCAAAGCTCGCGACAGGGCTCAA |
264 |
659 |
3521 |
Antisense | |
|
Affymetrix Proprietary Database | |