|
|
Cluster Members Consensus/Exemplar Group Members |
GeneChip Array Information |
|
188999_s_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.16397
|
|
Exemplar sequence
|
|
F45E1.6 NCBI
|
|
F45E1.6 /REP_DB=WormBase Gene ID /WP=CE01943 /TR=SW:Q10453 /GB=AAB04902.1 /SUBMIT=ST.LOUIS /CHR=X /FEA=Sanger Annotation /DEF=Histone H3
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_076943(11) |
|
|
|
|
|
NM_076943 NCBI |
Caenorhabditis elegans HIStone family member (his-71) (his-71) mRNA, complete cds. |
11/11 |
None |
SNAP00000004147 ENSEMBL |
cdna:SNAP chromosome:CEL140:X:7981488:7981996:-1 |
11/11 |
None |
GENEFINDER00000004155 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:X:7981488:7981996:-1 |
11/11 |
None |
F45E1.6.1 ENSEMBL |
cdna:known chromosome:CEL140:X:7981324:7982012:-1 gene:F45E1.6 |
11/11 |
None |
F45E1.6.2 ENSEMBL |
cdna:known chromosome:CEL140:X:7981328:7982017:-1 gene:F45E1.6 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrX:7981486-7981995(-) |
100.0 |
100.0 |
| |
Public Domain and Genome References |
|
Histone H3
|
|
his-71
|
|
F45E1.6
|
|
181057 Entrez gene
|
|
CE01943 Wormbase
|
Functional Annotations |
|
|
|
|
CANINE_2:CFA.7894.1.S1_S_AT |
similar to H3 histone, family 3B |
cfa |
DROSOPHILA_2:1623222_S_AT |
Histone H3.3B |
dm |
DROSGENOME1:142668_AT |
Histone H3.3B |
dm |
CHICKEN:GGA.4770.1.S1_AT |
H3 histone, family 3B (H3.3B) |
gga |
HG-U133_PLUS_2:211997_X_AT |
H3 histone, family 3B (H3.3B) |
hs |
HG-U133A_2:211997_X_AT |
H3 histone, family 3B (H3.3B) |
hs |
HG-U133A:211997_X_AT |
H3 histone, family 3B (H3.3B) |
hs |
HG-U133_PLUS_2:211998_AT |
H3 histone, family 3B (H3.3B) |
hs |
HG-U133A_2:211998_AT |
H3 histone, family 3B (H3.3B) |
hs |
HG-U133A:211998_AT |
H3 histone, family 3B (H3.3B) |
hs |
HG-U133_PLUS_2:211999_AT |
H3 histone, family 3B (H3.3B) |
hs |
HG-U133A_2:211999_AT |
H3 histone, family 3B (H3.3B) |
hs |
HG-FOCUS:211999_AT |
H3 histone, family 3B (H3.3B) |
hs |
HG-U133A:211999_AT |
H3 histone, family 3B (H3.3B) |
hs |
HG-U133_PLUS_2:209069_S_AT |
H3 histone, family 3B (H3.3B) |
hs |
HG-U133A_2:209069_S_AT |
H3 histone, family 3B (H3.3B) |
hs |
HG-U133A:209069_S_AT |
H3 histone, family 3B (H3.3B) |
hs |
HUGENEFL:Z48950_AT |
H3 histone, family 3B (H3.3B) |
hs |
U133_X3P:G12654576_3P_S_AT |
H3 histone, family 3B (H3.3B) |
hs |
U133_X3P:HS.180877.1.A4_3P_AT |
H3 histone, family 3B (H3.3B) |
hs |
U133_X3P:HS.180877.1.A3_3P_AT |
H3 histone, family 3B (H3.3B) |
hs |
U133_X3P:HS.180877.1.A1_3P_S_AT |
H3 histone, family 3B (H3.3B) |
hs |
HG-U95AV2:31510_S_AT |
H3 histone, family 3B (H3.3B) |
hs |
HG-U95D:90048_AT |
H3 histone, family 3B (H3.3B) |
hs |
HU35KSUBC:RC_N40168_AT |
H3 histone, family 3B (H3.3B) |
hs |
HG-U95B:45986_AT |
H3 histone, family 3B (H3.3B) |
hs |
HG-U95D:70062_AT |
H3 histone, family 3B (H3.3B) |
hs |
HG-U95D:88874_I_AT |
H3 histone, family 3B (H3.3B) |
hs |
HG-U95D:88877_R_AT |
H3 histone, family 3B (H3.3B) |
hs |
MOE430A:1420376_A_AT |
H3 histone, family 3B |
mm |
MOUSE430A_2:1420376_A_AT |
H3 histone, family 3B |
mm |
MOUSE430_2:1420376_A_AT |
H3 histone, family 3B |
mm |
MOUSE430_2:1455725_A_AT |
H3 histone, family 3B |
mm |
MOE430A:1455725_A_AT |
H3 histone, family 3B |
mm |
MOUSE430A_2:1455725_A_AT |
H3 histone, family 3B |
mm |
MU11KSUBB:X13605_S_AT |
H3 histone, family 3B |
mm |
MG-U74AV2:100708_AT |
H3 histone, family 3B |
mm |
MG-U74BV2:115301_R_AT |
H3 histone, family 3B |
mm |
MOE430B:1430357_AT |
H3 histone, family 3B |
mm |
MOUSE430_2:1430357_AT |
H3 histone, family 3B |
mm |
MU19KSUBA:TC23443_I_AT |
H3 histone, family 3B |
mm |
MU19KSUBC:TC41710_AT |
H3 histone, family 3B, mRNA (cDNA clone MGC:47401 IMAGE:4500770) |
mm |
RG-U34A:RC_AI177503_AT |
H3 histone, family 3B |
rn |
RG-U34B:RC_AI010256_AT |
H3 histone, family 3B |
rn |
RG-U34C:RC_AI169289_AT |
H3 histone, family 3B |
rn |
RG-U34C:RC_AI170709_AT |
H3 histone, family 3B |
rn |
RG-U34C:RC_AI136747_S_AT |
H3 histone, family 3B |
rn |
RAE230A:1390019_AT |
H3 histone, family 3B |
rn |
RAT230_2:1390019_AT |
H3 histone, family 3B |
rn |
RAE230A:1398888_AT |
H3 histone, family 3B |
rn |
RAT230_2:1398888_AT |
H3 histone, family 3B |
rn |
RAE230A:1370190_AT |
H3 histone, family 3B |
rn |
RAT230_2:1370190_AT |
H3 histone, family 3B |
rn |
RAE230A:1398849_AT |
H3 histone, family 3B |
rn |
RAT230_2:1398849_AT |
H3 histone, family 3B |
rn |
RG-U34A:RC_AA875069_AT |
H3 histone, family 3B |
rn | |
|
|
|
|
|
6334 |
nucleosome assembly |
inferred from electronic annotation |
QuickGO AmiGO |
7001 |
chromosome organization and biogenesis (sensu Eukaryota) |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
786 |
nucleosome |
inferred from electronic annotation |
QuickGO AmiGO |
5634 |
nucleus |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
3677 |
DNA binding |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
AAB04902 |
Histone protein 71 [Caenorhabditis elegans] ref|NP_509344.1| HIStone family member (his-71) [Caenorhabditis elegans] sp|Q10453|H33_CAEEL Histone H3.3 |
2.0E-70 |
blast |
CAE70330 |
Hypothetical protein CBG16863 [Caenorhabditis briggsae] |
3.0E-70 | |
|
|
|
|
|
Pfam |
IPR007125 EMBL-EBI |
Histone core |
2.7E-29 | |
Sequence |
|
>C. ELEGANS:188999_S_AT
aagcaaaccgcgcgtaaatcaactggaggaaaagctcctcgcaagcagctggccactaag
gcggctcgcaagtcagctccaactaccggaggtgtcaagaaaccacatcgttatcgtcca
ggaaccgtcgctcttcgtgagattcgtcgttaccaaaagtccaccgagcttctcatccgc
aagcttccattccaacgtcttgttcgtgaaatcgctcaagatttcaagaccgatctccgt
ttccaatccgccgccatcggagctctgcaagaggcttctgaggcctacctcg
BLASTn GenBank NR |
|
|
|
|
|
|
AAGCAAACCGCGCGTAAATCAACTG |
580 |
149 |
25 |
Antisense |
ACCGCGCGTAAATCAACTGGAGGAA |
665 |
81 |
31 |
Antisense |
GGAGGAAAAGCTCCTCGCAAGCAGC |
583 |
515 |
49 |
Antisense |
TCGCAAGCAGCTGGCCACTAAGGCG |
322 |
601 |
63 |
Antisense |
CAAGCAGCTGGCCACTAAGGCGGCT |
620 |
185 |
66 |
Antisense |
CAAGTCAGCTCCAACTACCGGAGGT |
285 |
183 |
93 |
Antisense |
GTCAGCTCCAACTACCGGAGGTGTC |
74 |
467 |
96 |
Antisense |
GCTCCAACTACCGGAGGTGTCAAGA |
580 |
297 |
100 |
Antisense |
CGGAGCTCTGCAAGAGGCTTCTGAG |
427 |
243 |
282 |
Antisense |
AGCTCTGCAAGAGGCTTCTGAGGCC |
212 |
81 |
285 |
Antisense |
CAAGAGGCTTCTGAGGCCTACCTCG |
265 |
185 |
292 |
Antisense | |
|
Affymetrix Proprietary Database | |