|
|
Cluster Members Consensus/Exemplar |
GeneChip Array Information |
|
188708_at |
|
C. elegans Genome Array |
|
Nematode |
Probe Design Information |
|
affy.Ce.11477
|
|
Exemplar sequence
|
|
C50F4.7 NCBI
|
|
C50F4.7 /REP_DB=WormBase Gene ID /WP=CE03252 /GEN=his-37 /GB=CAA94742.1 /SUBMIT=HINXTON /CHR=5 /FEA=Sanger Annotation /DEF=histone H4
|
This cluster is supported by a Sanger Annotation. |
Annotation Method Description |
|
This probe set was annotated using the Matching Probes based pipeline to a RefSeq identifier using 1 transcript(s). |
|
This is a grade A annotation. |
|
NM_073065(11) |
|
|
|
|
|
NM_073065 NCBI |
Caenorhabditis elegans HIStone family member (his-37) (his-37) mRNA, complete cds. |
11/11 |
None |
SNAP00000009319 ENSEMBL |
cdna:SNAP chromosome:CEL140:V:9549718:9550103:1 |
11/11 |
None |
GENEFINDER00000009331 ENSEMBL |
cdna:GeneFinder chromosome:CEL140:V:9549718:9550103:1 |
11/11 |
None |
C50F4.7 ENSEMBL |
cdna:known chromosome:CEL140:V:9549671:9550193:1 gene:C50F4.7 |
11/11 |
None | |
There are no noteworthy cross hybridizing mRNAs found for this probe set. | |
Genomic Alignment of Consensus/Exemplar Sequence |
|
Wormbase March 2004 |
|
|
|
|
|
chrV:9549717-9550103(+) |
100.0 |
100.0 |
|
chrV:8892075-8892387(-) |
90.38 |
90.38 |
|
chrV:8849980-8850292(-) |
90.38 |
90.38 |
| |
Public Domain and Genome References |
|
histone H4
|
|
his-37
|
|
C50F4.7
|
|
179341 Entrez gene
|
|
P62784 EMBL-EBI
|
|
CE03252 Wormbase
|
Functional Annotations |
|
|
|
|
CANINE_2:CFAAFFX.251.1.S1_S_AT |
similar to germinal histone H4 gene |
cfa |
HG-U133_PLUS_2:214516_AT |
histone 1, H4b |
hs |
HG-U133A_2:214516_AT |
histone 1, H4b |
hs |
HG-FOCUS:214516_AT |
histone 1, H4b |
hs |
HG-U133A:214516_AT |
histone 1, H4b |
hs |
HG-U95AV2:33049_AT |
histone 1, H4b |
hs |
HUGENEFL:X67081_AT |
histone 1, H4b |
hs |
U133_X3P:HS.143080.0.S1_3P_AT |
histone 1, H4b |
hs |
MOUSE430A_2:1422947_AT |
histone 1, H4b |
mm |
MOE430A:1422947_AT |
histone 1, H4b |
mm |
MOUSE430_2:1422947_AT |
histone 1, H4b |
mm |
MU11KSUBB:MSA.2339.0_AT |
histone 1, H4b |
mm |
MG-U74BV2:165373_AT |
histone 1, H4b |
mm |
MOE430A:1422948_S_AT |
histone 1, H4b |
mm |
MOUSE430A_2:1422948_S_AT |
histone 1, H4b |
mm |
MOUSE430_2:1422948_S_AT |
histone 1, H4b |
mm | |
|
|
|
|
|
6334 |
nucleosome assembly |
inferred from electronic annotation |
QuickGO AmiGO |
7001 |
chromosome organization and biogenesis (sensu Eukaryota) |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
786 |
nucleosome |
inferred from electronic annotation |
QuickGO AmiGO |
5634 |
nucleus |
inferred from electronic annotation |
QuickGO AmiGO |
|
|
|
|
3677 |
DNA binding |
inferred from electronic annotation |
QuickGO AmiGO | |
|
|
|
|
|
blast |
CAB05839 |
Hypothetical protein ZK131.8 [Caenorhabditis elegans] emb|CAB05837.1| Hypothetical protein ZK131.4 [Caenorhabditis elegans] emb|CAB05835.4| Hypothetical protein ZK131.1 [Caenorhabditis elegans] emb|CAB03396.1| Hypothetical protein T23D8.5 [Caenorhabditis elegans] emb|CAA94742.1| Hypothetical protein C50F4.7 [Caenorhabditis elegans] emb|CAA97407.1| Hypothetical protein B0035.9 [Caenorhabditis elegans] emb|CAA92734.1| Hypothetical protein F22B3.1 [Caenorhabditis elegans] emb|CAB07657.1| Hypothetical protein T10C6.14 [Caenorhabditis elegans] emb|CAB05210.1| Hypothetical protein F54E12.3 [Caenorhabditis elegans] gb|AAC05101.1| Histone protein 31 [Caenorhabditis elegans] gb|AAK84518.1| Histone protein 50 [Caenorhabditis elegans] gb|AAF98220.1| Histone protein 28 [Caenorhabditis elegans] gb|AAF98223.1| Histone protein 18 [Caenorhabditis elegans] gb|AAA83329.1| Histone protein 38 [Caenorhabditis elegans] emb|CAA24645.1| unnamed protein product [Strongylocentrotus purpuratus] emb|CAA38053.1| histone H4 [Pycnopodia helianthoides] emb|CAA38051.1| histone H4 [Pisaster ochraceus] emb|CAA38049.1| H4 histone [Pisaster brevispinus] emb|CAA33643.1| Histone protein [Caenorhabditis elegans] emb|CAA27581.1| unnamed protein product [Strongylocentrotus purpuratus] emb|CAA25241.1| unnamed protein product [Lytechinus pictus] gb|AAC48026.1| Histone protein 5 [Caenorhabditis elegans] ref|NP_509231.1| K03A1.6 [Caenorhabditis elegans] ref|NP_501406.1| HIStone family member (his-31) [Caenorhabditis elegans] ref|NP_496893.1| HIStone family member (his-10) [Caenorhabditis elegans] ref|NP_507034.1| HIStone family member (his-1) [Caenorhabditis elegans] ref|NP_492641.1| HIStone family member (his-67) [Caenorhabditis elegans] ref|NP_505466.1| HIStone family member (his-37) [Caenorhabditis elegans] ref|NP_505298.1| HIStone family member (his-18) [Caenorhabditis elegans] ref|NP_505291.1| HIStone family member (his-28) [Caenorhabditis elegans] ref|NP_505275.1| HIStone family member (his-50) [Caenorhabditis elegans] ref|NP_505200.1| HIStone family member (his-5) [Caenorhabditis elegans] ref|NP_502154.1| HIStone family member (his-64) [Caenorhabditis elegans] ref|NP_502139.1| HIStone family member (his-56) [Caenorhabditis elegans] ref|NP_502133.1| HIStone family member (his-46) [Caenorhabditis elegans] ref|NP_496896.1| HIStone family member (his-26) [Caenorhabditis elegans] ref|NP_496889.1| HIStone family member (his-14) [Caenorhabditis elegans] ref|XP_780884.1| PREDICTED: similar to histone (his-67) [Strongylocentrotus purpuratus] ref|XP_781796.1| PREDICTED: similar to histone (his-67) [Strongylocentrotus purpuratus] ref|NP_999707.1| H4 histone protein [Strongylocentrotus purpuratus] ref|NP_999716.1| late histone gene L1 H4 [Strongylocentrotus purpuratus] ref|NP_999715.1| late histone gene L2 H4 [Strongylocentrotus purpuratus] ref|NP_999713.1| late embryonic histone H4 [Strongylocentrotus purpuratus] sp|P62779|H4_PYCHE Histone H4 sp|P62778|H4_PISOC Histone H4 sp|P62777|H4_PISBR Histone H4 sp|P62780|H4_PARLI Histone H4 sp|P62782|H4_LYTPI Histone H4 sp|P62776|H4_HOLTU Histone H4 sp|P62784|H4_CAEEL Histone H4 emb|CAE60210.1| Hypothetical protein CBG03774 [Caenorhabditis briggsae] emb|CAE72198.1| Hypothetical protein CBG19306 [Caenorhabditis briggsae] emb|CAE62043.1| Hypothetical protein CBG06059 [Caenorhabditis briggsae] emb|CAE62040.1| Hypothetical protein CBG06056 [Caenorhabditis briggsae] emb|CAE61894.1| Hypothetical protein CBG05885 [Caenorhabditis briggsae] emb|CAE61864.1| Hypothetical protein CBG05842 [Caenorhabditis briggsae] emb|CAE61861.1| Hypothetical protein CBG05839 [Caenorhabditis briggsae] emb|CAE75444.1| Hypothetical protein CBG23438 [Caenorhabditis briggsae] emb|CAE58375.1| Hypothetical protein CBG01504 [Caenorhabditis briggsae] emb|CAE58373.1| Hypothetical protein CBG01500 [Caenorhabditis briggsae] gb|AAB48834.1| cleavage stage histone H4 [Psammechinus miliaris] pir||S01618 histone H4, embryonic (clones L1 and L2) - sea urchin (Strongylocentrotus purpuratus) emb|CAA86298.1| histone H4 [Holothuria tubulosa] emb|CAA29849.1| unnamed protein product [Strongylocentrotus purpuratus] emb|CAA29847.1| unnamed protein product [Strongylocentrotus purpuratus] emb|CAA76307.1| histone H4 [Paracentrotus lividus] emb|CAA25630.1| histone H4 (aa 1-103) [Psammechinus miliaris] sp|P62783|H4_STRPU Histone H4 sp|P62781|H4_PSAMI Histone H4 gb|AAA69664.1| histone gb|AAA30024.1| histone H4 gb|AAA30002.1| histone H4 prf||2209257B histone H4 |
7.0E-40 |
blast |
AAB00649 |
Histone protein 60 [Caenorhabditis elegans] ref|NP_501203.1| F55G1.11 [Caenorhabditis elegans] pir||T29230 hypothetical protein F55G1.11 - Caenorhabditis elegans |
7.0E-40 |
blast |
HSUR4P |
histone H4, embryonic - sea urchin (Strongylocentrotus purpuratus) pir||HSUR4 histone H4 - sea urchin (Psammechinus miliaris) pir||S68537 histone H4 - starfish (Asterina pectinifera) gb|AAA30054.1| H4 histone protein |
7.0E-40 | |
|
|
|
|
|
Pfam |
IPR007125 EMBL-EBI |
Histone core |
5.3E-13 | |
Sequence |
|
>C. ELEGANS:188708_AT
agggaggtgctaaacggcatcgtaaagttcttcgtgacaacatccagggaatcacaaagc
cagcaattcgccgtctcgctcgtcgtggtggagtcaaacgtatctctggacttatctacg
aggaaactcgtggagttctgaaggtcttccttgaaaatgtcattcgtgatgctgtcactt
actgtgagcacgccaaaagaaagactgtaaccgcgatggacgttgtctat
BLASTn GenBank NR |
|
|
|
|
|
|
AGGGAGGTGCTAAACGGCATCGTAA |
113 |
51 |
50 |
Antisense |
GGCATCGTAAAGTTCTTCGTGACAA |
206 |
537 |
65 |
Antisense |
AACATCCAGGGAATCACAAAGCCAG |
409 |
135 |
88 |
Antisense |
GGGAATCACAAAGCCAGCAATTCGC |
498 |
491 |
96 |
Antisense |
GTATCTCTGGACTTATCTACGAGGA |
270 |
455 |
149 |
Antisense |
AACTCGTGGAGTTCTGAAGGTCTTC |
651 |
141 |
174 |
Antisense |
GTGGAGTTCTGAAGGTCTTCCTTGA |
213 |
491 |
179 |
Antisense |
GGTCTTCCTTGAAAATGTCATTCGT |
173 |
503 |
192 |
Antisense |
GAGCACGCCAAAAGAAAGACTGTAA |
352 |
389 |
235 |
Antisense |
GAAAGACTGTAACCGCGATGGACGT |
39 |
361 |
248 |
Antisense |
TGTAACCGCGATGGACGTTGTCTAT |
441 |
547 |
255 |
Antisense | |
|
Affymetrix Proprietary Database |